Skip to main content

Table 3 Primers used for qRT-PCR

From: The CD200R1 microglial inhibitory receptor as a therapeutic target in the MPTP model of Parkinson’s disease

Species: Mus musculus
Target mRNA Accession number Forward primer (5′➔3′) Reverse primer (5′➔3′)
Arg1 NM_007482.3 TTGCGAGACGTAGACCCTGG CAAAGCTCAGGTGAATCGGC
Cd200full NM_010818.3 GGGCATGGCAGCAGTAGCG TGTGCAGCGCCTTTCTTTC
Cd200tr NM_001358443.1 GATGGGCAGTCTGTGGAAGTG GAGAACATCGTAAGGATGCAGTTG
Cd200R1 NM_021325.3 AGGAGGATGAAATGCAGCCTTA TGCCTCCACCTTAGTCACAGTATC
COX2 NM_011198.4 TGCAGAATTGAAAGCCCTCT CCCCAAAGATAGCATCTGGA
gp91phox NM_007807.5 ACTCCTTGGGTCAGCACTGGCT GCAACACGCACTGGAACCCCT
IL10 NM_010548.2 TGAATTCCCTGGGTGAGAAG ACACCTTGGTCTTGGAGCTT
IL1β NM_008361.4 TGGTGTGTGACGTTCCCATTA CAGCACGAGGCTTTTTTGTTG
IL6 NM_031168.2 CCAGTTTGGTAGCATCCATC CCGGAGAGGAGACTTCACAG
iNOS NM_010927.3 GGCAGCCTGTGAGACCTTTG GCATTGGAAGTGAAGCGTTTC
MR NM_008625.2 TCTTTTACGAGAAGTTGGGGTCAG ATCATTCCGTTCACCAGAGGG
Nrf2 NM_010902.4 GATCCGCCAGCTACTCCCAGGTTG CAGGGCAAGCGACTCATGGTCATC
TGFβ NM_011577.2 TGCGCTTGCAGAGATTAAAA AGCCCTGTATTCCGTCTCCT
TNFα NM_013693.3 TGATCCGCGACGTGGAA ACCGCCTGGAGTTCTGGAA
Reference genes
βactin NM_007393.5 CAACGAGCGGTTCCGATG GCCACAGGATTCCATACCCA
Gapdh NM_008084.3 GGTGAAGGTCGGTGTGAACG CTCGCTCCTGGAAGATGGTG
  1. Arg1, arginase 1; CD200full, full-length CD200; CD200tr, truncated CD200; CD200R1, CD200 receptor 1; COX2, cyclooxygenase 2; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; gp91phox, catalytic subunit of NADPH oxidase; IL10, interleukin 10; IL1β, interleukin 1β; IL6, interleukin 6; iNOS, inducible nitric oxide synthase; MR, mannose receptor; Nrf2, nuclear factor erythroid 2-related factor 2; TGFβ, transforming growth factor β; TNFα, tumour necrosis factor α