Skip to main content

Table 2 Primers used for qPCR

From: Viscoelastic properties of white and gray matter-derived microglia differentiate upon treatment with lipopolysaccharide but not upon treatment with myelin

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
Aif1 GCCTCATCGTCATCTCCCCA AGGAAGTGCTTGTTGATCCCA
Gfap CAGACTTTCTCCAACCTCCAG CTCCTGCTTCGAGTCCTTAATG
Il-1β GCCACCTTTTGACAGTGATG CTTCTCCACAGCCACAATGA
Il-6 CCCCAACTTCCAATGCTCTC AGATGAGTTGGATGGTCTTGGTC
Tnfα CCACACCGTCAGCCGATT TCCTTAGGGCAAGGGCTCTT
Hla-dr CACACTTGGAGACCTGGTGAT AACTCCGCCTGGATGATGGT
Cd74 ATGGCTACTCCCTTGCTGATG GTAGTTCACGGGTCCAGACT
B2m GAGCCCAAAACCGTCACCT ACCGGATCTGGAGTTAAACTGG
Gapdh GAACATCATCCCTGCATCCA GCCAGTGAGCTTCCCGTTCA
Hprt1 CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC
\