Skip to main content

Table 1 List of primers used for RT-qPCR

From: Complete spatial characterisation of N-glycosylation upon striatal neuroinflammation in the rodent brain

Gene/Primer Forward sequence Reverse sequence
Ppia/Cyclo (housekeeping) ATGGCAAATGCTGGACCAAA GCCTTCTTTCACCTTCCCAAA
Rplp0 (housekeeping) CAGGCGTCCTCATTAGAG ATCTGCTGCATCTGCTTGGAG
Hprt1 (housekeeping) GGACCTCTCGAAGTGTTGGATAC CCCTGAAGTGCTCATTATAGTCAA
GFAP AATGACTATCGCCGCCAAC CTCCTGGTAACTCGCCGACT
IBA1 CCAGCCTAAGACAACCAGCGTC GCTGTATTTGGGATCATCGAGGAA
TNFα AAATGGGCTCCCTCTCATCAGTTC TCTGCTTGGTGGTTTGCTACGAC
TSPO/PBR CAGTGTCCTTCACGGAGCAG CGGGTACCCAGGATTGAGAC
Vimentin GCAAAGCAGGAGTCAAACGA AATTCTCTTCCATTTCACGCATCT