Skip to main content

Table 1 Primers used for qPCR in this study

From: miR-155 and miR-146a collectively regulate meningitic Escherichia coli infection-mediated neuroinflammatory responses

Gene Forward (5’–3’) Reverse (5’–3’) Species
IRAK1 GCACCCACAACTTCTCGGAG CACCGTGTTCCTCATCACCG Human
TRAF6 TTGCCATGAAAAGATGCAGAGG AGCCTGGGCCAACATTCTC Human
TAB2 GCAGCAAAGGAACATCTAGCC TGGACTGTTAAGTACAGGTGGA Human
EGFR TGCCACCTGTGCCATCCA ACCACCAGCAGCAAGAGGAG Human
GAPDH TGCCTCCTGCACCACCAACT CGCCTGCTTCACCACCTTC Human
MIR155HG GCGAGCAGAGAATCTACCT TCTAAGCCTCACAACAACCT Human
pri-mir146a CTCCTCTGTCACCAAGTAA CCTCTAACCTTCTGCCTAA Human
IL1β ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA Human
IL6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG Human
TNF-α CGAGTGACAAGCCTGTAG GGACCTGGGAGTAGATGA Human
MCP-1 CAGCCAGATGCAATCAATGCC TGGAATCCTGAACCCACTTCT Human
CXCL2 AGTGTGAAGGTGAAGTCC CTTTCTGCCCATTCTTGAG Human
IL1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Murine
IL6 TTCCATCCAGTTGCCTTCT AAGCCTCCGACTTGTGAA Murine
TNF-α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG Murine
MCP-1 TGTGAAGTTGACCCGTAA TCCTACAGAAGTGCTTGAG Murine
CXCL2 TGACTTCAAGAACATCCAGAG CCTTGCCTTTGTTCAGTATCT Murine
β-actin GTCCCTCCTCTGATACCTTCCTC CTGGCAGTGTCATTCACATCTTTCT Murine