Skip to main content

Table 1 Primers used in real-time PCR

From: TAK1 mediates neuronal pyroptosis in early brain injury after subarachnoid hemorrhage

Gene Sense primer (5′-3′) Antisense primer (3′-5′)
NLRP3 GCATTGCTTCGTAGATAGAGG GATGAAGGACCCACAGTGTAA
IL-1β TTGTTCATCTCGGAGCCTGTA AGCACCTTCTTTTCCTTCATC
IL-18 ACCACTTTGGCAGACTTCACT ACACAGGCGGGTTTCTTTTG
GAPDH AAGAAGGTGGTGAAGCAGG GAAGGTGGAAGAGTGGGAGT