Skip to main content

Table 1 Primer sequences used for real-time PCR

From: Sex differences and similarities in the neuroimmune response to central administration of poly I:C

Gene target Forward primer
sequence (5′ to 3′)
Reverse primer
sequence (5′ to 3′)
NCBI reference
sequence
ccl2 CCACAACCACCTCAAGCACT AAGGCATCACAGTCCGAGT NM_011333.3
cd11b CGTGAATGGGGACAAACTGAC GCACTGAGGCTGGCTATTGA NM_008401.2
cxcl10 TCCATCACTCCCCTTTACCCA TGGCTTGACCATCATCCTGC NM_021274.2
gfap AAACCGCATCACCATTCCTG CCCGCATCTCCACAGTCTTTA NM_010277.3
ifnα AGAGAAGAAACACAGCCCCT AGCACATTGGCAGAGGAAGA NM_010502.2
ifnβ GCTCCAAGAAAGGACGAACAT GGATGGCAAAGGCAGTGTAA NM_010510.1
ifnγ GTCAACAACCCACAGGTCCA CGACTCCTTTTCCGCTTCCT NM_008337.4
il-1β TGCCACCTTTTGACAGTGATG GCTCTTGTTGATGTGCTGCT NM_008361.4
il-6 GAGACTTCCATCCAGTTGCCT TCATTTCCACGATTTCCCAGAG NM_001314054.1
il-10 CTGGACAACATACTGCTAACCG AATGCTCCTTGATTTCTGGGC NM_010548.2
tnfα ACCCCTTTACTCTGACCCCTT ACTGTCCCAGCATCTTGTGT NM_001278601.1