Skip to main content

Table 1 The specific sequence of primers

From: Sodium phenylbutyrate inhibits Schwann cell inflammation via HDAC and NFκB to promote axonal regeneration and remyelination

Gene name Forward (F)/ Reverse (R) Primer sequence
TNFα F TCAACCTCCTCTCTGCCATC
R CCAAAGTAGACCTGCCCAGA
IL-1β F CTGTCCTGCGTGTTGAAAGA
R CTGCTTGAGAGGTGCTGATG
IL-6 F AGGAGACTTGCCTGGTGAAA
R CAGGGGTGGTTATTGCATCT
GAPDH F CATCAAGAAGGTGGTGAAGC
R TGACAAAGTGGTCGTTGAGG