Skip to main content

Table 1 List of primers used for quantitative real-time RT-PCR

From: Self-extracellular RNA promotes pro-inflammatory response of astrocytes to exogenous and endogenous danger signals

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
Il-6 AGTTGCCTTCTTGGGACTGA TCCACGATTTCCCAGAGAAC
Mcp-1 CCCAATGAGTAGGCTGGAGA TCTGGACCCATTCCTTCTTG
Rps12 GAAGCTGCCAAAGCCTTAGA AACTGCAACCAACCACCTTC
Tlr1 CTTACCAGAGTGCCCAAGGA ACCCTCAGCTTGGACAATGA
Tlr2 CTGAGAATGATGTGGGCGTG TTAAAGGGCGGGTCAGAGTT
Tlr3 TTGCGTTGCGAAGTGAAGAA TGTTCAAGAGGAGGGCGAAT
Tlr4 TGGGTGAGAAATGAGCTGGT ACCACAATAACCTTCCGGCT
Tnf CGTCAGCCGATTTGCTATCT CGGACTCCGCAAAGTCTAAG
  1. Il-6 interleukin-6, Mcp-1 monocyte chemoattractant protein-1, Rps12 ribosomal protein S12, Tlr Toll-like receptor, Tnf tumor necrosis factor alpha