Skip to main content

Table 1 Sequences for transfection

From: AMPK-autophagy-mediated inhibition of microRNA-30a-5p alleviates morphine tolerance via SOCS3-dependent neuroinflammation suppression

Name Sequence (5ʹ–3ʹ)
Socs3 siRNA (mouse)
 Sense GUAUGAUGCUCCACUUUAATT
 Anti-sense UUAAAGUGGAGCAUCAUACTT
Atg5 siRNA (mouse)
 Sense CAUCAACCGGAAACUCAUTT
 Anti-sense AUGAGUUUCCGGUUGAUGTT
microRNA-30a-5p mimic
 Sense UGUAAACAUCCUCGACUGGAAG
 Anti-sense UCCAGUCGAGGAUGUUUACAUU
microRNA-203-3p mimic
 Sense GUGAAAUGUUUAGGACCACUAG
 Anti-sense AGUGGUCCUAAACAUUUCACUU
microRNA-19a-3p mimic
 Sense UGUGCAAAUCUAUGCAAAACUGA
 Anti-sense AGUUUUGCAUAGAUUUGCACAUU
microRNA-455-5p mimic
 Sense UAUGUGCCUUUGGACUACAUCG
 Anti-sense AUGUAGUCCAAAGGCACAUAUU
microRNA-218-5p mimic
 Sense UUGUGCUUGAUCUAACCAUGU
 Anti-sense AUGGUUAGAUCAAGCACAAUU
microRNA-30a-5p inhibitor CUUCCAGUCGAGGAUGUUUACA
Control siRNA
 Sense UUCUCCGAACGUGUCACGUTT
 Anti-sense ACGUGACACGUUCGGAGAATT
Control mimic
 Sense UUCUCCGAACGUGUCACGUTT
 Anti-sense ACGUGACACGUUCGGAGAATT
Control microRNA inhibitor CAGUACUUUUGUGUAGUACAA