Skip to main content

Table 2 Sequences of primers for real-time quantitative polymerase chain reaction

From: AMPK-autophagy-mediated inhibition of microRNA-30a-5p alleviates morphine tolerance via SOCS3-dependent neuroinflammation suppression

Gene Sequence (5ʹ–3ʹ)
β-actin (mouse)
 Forward CATTGCTGACAGGATGCAGAAGG
 Reverse TGCTGGAAGGTGGACAGTGAGG
Socs3 (mouse)
 Forward GCTCCAAAAGCGAGTACCAGC
 Reverse AGTAGAATCCGCTCTCCTGCAG
Tnfα (mouse)
 Forward CATCTTCTCAAAATTCGAGTGA
 Reverse TGGGAGTAGACAAGGTACAA
Il1b (mouse)
 Forward TCATTGTGGCTGTGGAGAAG
 Reverse AGGCCACAGGTATTTTGTCG
  1. Il-1b interleukin-1β, Tnf-a tumor necrosis factor-α, Socs3 suppressor of cytokine signaling 3