Skip to main content

Table 1 Specific primer sequences for target genes

From: Nicotinamide reverses deficits in puberty-born neurons and cognitive function after maternal separation

Gene Sense primer Anti-sense primer
TNF-α CTGGCGTGTTCATCCGTTCT AGCCCATTGGAATCCTTGC
IL-1β TGTGATGTTCCCATTAGAC AATACCACTTGTTGGCTTA
IL-6 CCACTGCCTTCCCTACTT TTGGTCCTTAGCCACTCC
GAPDH GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT