Skip to main content
Download PDF

Aberrant copper metabolism and hepatic inflammation cause neurological manifestations in a mouse model of Wilson’s disease

Journal of Neuroinflammation volume 21, Article number: 235 (2024) Cite this article

Abstract

Pathogenic germline mutations in the P-type copper-transporting ATPase (ATP7B) gene cause Wilson’s disease (WD), a hereditary disorder characterized by disrupted copper metabolism. The Arg778Leu (R778L) mutation in exon 8 is prevalent among individuals with WD in East Asia and is associated with more severe phenotypes. In this study, we generated a WD mouse model harboring R778L mutation (R778L mice) using CRISPR/Cas9. R778L mice exhibit a range of pathological characteristics resembling those of patients with WD and the same point mutations, including aberrant copper metabolism, pathological cellular injury, inflammation, and severe hepatic fibrosis. At 3–5 months of age, these mice started to display neurological deficits in motor coordination and cognitive dysfunction, accompanied by increased expression of inflammatory cytokines in the central nervous system. Microglia in the striatum and cortex exhibit significant activation, shorter processes, and decreased branch points. However, the Cu2+ levels in the brain tissue of R778L mice did not differ significantly from those of wild-type mice. Notably, inhibition of hepatic inflammation with PJ34 or siNfkb markedly alleviated the deficiencies in cognitive performance and improved locomotor activity in R778L mice. Thus, this study establishes a novel murine model to investigate the pathophysiology of WD, highlights the liver-brain crosstalk responsible for neurological manifestations in individuals with WD caused by the R778L point mutation, and demonstrates the potential of modulating liver inflammation as a therapeutic strategy for alleviating the neurological manifestations of WD.

Introduction

Wilson’s disease (WD) is a genetic disorder of copper metabolism that exhibits an autosomal recessive inheritance pattern. It arises from mutations in the P-type copper-transporting ATPase (ATP7B) gene located on human chromosome 13q14.3 [1]. WD has been documented worldwide across diverse geographical regions and ethnic groups [2,3,4]. The liver is the primary organ responsible for copper metabolism in the human body. In individuals with WD, reduced ATP7B functionality leads to decreased hepatic synthesis of ceruloplasmin (CP). Consequently, this disrupts the excretion of Cu2+ into bile and results in excessive accumulation of Cu2+ within hepatocytes, ultimately causing hepatocyte damage and fibrosis [5]. In addition to hepatic manifestations, patients with WD often exhibit neurological symptoms, presenting with varying degrees of movement disorders, such as tremor, dystonia, and parkinsonism, and non-motor neurological dysfunction, such as dysarthria, dysphagia, psychiatric disorders, cognitive dysfunction, and personality disorders [6]. Postmortem investigations have revealed a marked elevation in Cu2+ levels within the basal ganglia and cortex of individuals with WD [7]. Despite the association between brain Cu2+ concentrations and WD, the pathogenic mechanisms underlying the neurological manifestations of WD remain unknown.

The discovery of the copper-transporting ATPase (ATP7B) has been a significant milestone in our understanding of the genetic basis and pathophysiology of WD. However, in-depth research on the molecular mechanisms of WD has been hindered by the low incidence of the disease and the difficulty in obtaining human tissue samples. Research on animal models is valuable for understanding its etiology and pathogenesis and for developing effective therapeutic treatments. Currently, the animal models commonly used in WD research are Atp7b−/− (knockout) mice, Jackson toxic milk (tx-j) mice and toxic milk (tx) mice. Both exhibit genetic Cu2+ overload, mimicking the pathophysiological processes observed in patients with WD [8]. The absence of Atp7b disrupts copper homeostasis in Atp7b−/− mice, resulting in diminished serum CP levels, increased urinary Cu2+ excretion, hepatic Cu2+ accumulation, and the early onset of liver pathology [9]. However, no notable neurobehavioral alterations or pathological brain damage has been observed in Atp7b−/− mice [10]. Tx-j mice carry an inherent recessive point mutation at position 2135 in exon 8 that leads to a G712D missense mutation in the second transmembrane region of Atp7b. The clinical phenotype observed in tx-j mice closely resembles that observed in patients with WD. Initially, hepatocyte morphology of tx-j mice is normal; however, as the mice reach the age of 3–4 months, hepatocyte nuclei begin to enlarge [11]. Furthermore, starting from the age of 5 months, tx-j mice exhibit increased infiltration of inflammatory cells in the liver, mild microvascular steatosis, and altered spatial memory, learning abilities, and exploratory behaviors. However, these neurological manifestations differ from those observed in humans with WD [12]. Tx mice carrying the Met1356Val mutation in the Atp7b gene on chromosome 8 displayed slow growth, reduced pigmentation, and tremors. Young mice exhibit significant copper accumulation in the hepatic tissue, leading to liver damage. By 6 months of age, these mice develop nodular fibrosis, bile duct proliferation, and inflammatory cell infiltration in the liver. The liver tissue of tx mice exhibits pathological alterations and ultrastructural abnormalities resembling those observed in patients with hepatic WD. However, apart from tremors in neonatal tx mice due to copper deficiency, no prominent neurological symptoms were observed in tx mice. Therefore, the existing animal models do not accurately reflect the pathogenesis and clinical neurological phenotypes observed in individuals with WD. Consequently, the underlying mechanisms have not been fully elucidated. Therefore, there is an urgent need to develop a robust and pathologically relevant mouse model of human WD to investigate the mechanisms involved in its pathophysiology.

In this study, we developed a mouse model with the missense mutation p. Arg778Leu in Atp7b (R778L mice) is one of the most common pathogenic alleles in individuals with WD among East Asian populations. By examining the clinical phenotype of the mutant mouse from both a physiological and pathological perspective, we validated its similarity to the clinical manifestations observed in patients with WD. We conducted a comparative analysis of the phenotypes of the tx-j mice. This investigation lays the groundwork for further studies to elucidate the potential mechanisms responsible for neurological symptoms associated with WD.

Materials and methods

Animals

To establish an animal model with the CRISPR/Cas9-mediated Atp7b point mutation (p.R778L), a single guide RNA (sgRNA) was designed to direct the Cas9 protein to cleave DNA at the p.R778 site (Additional file 1: Fig. S1A). CRISPR/Cas reagents (Cas9 mRNA, sgRNA, and donor oligonucleotides) were injected into the fertilized mouse zygotes. The zygotes were immediately transferred to pseudo-pregnant female mice and the pups were genotyped (Additional file 1: Fig. S1B). Subsequently, founder mice carrying the predicted genotype were bred with wild-type (WT) C57BL/6J mice to produce the F1 generation. F1 mice were inbred to produce homozygous mice (Additional file 1: Fig. S1C). Male and female C3HeB/FeJ (WT C3H) and C3HeB/FeJ-Atp7btx-J/J (tx-j) mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA).

The animals used in this study were bred at the Institute of Neurology, Anhui University of Chinese Medicine, under standard laboratory conditions (12-h light/dark cycle, 20–22 °C ambient temperature, and 50–60% humidity), with ad libitum access to standard chow and water. Animal experiments were conducted with ethical approval from the Animal Ethics Committee of the Anhui University of Chinese Medicine (AHUCM-mouse-2,023,130). The animals were handled according to the guidelines outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. At the end of the experiment, 52 R778L male mice and 50 tx-j male mice were euthanized, and tissues were collected for further analysis.

To block poly (ADP-ribose) polymerase (PARP) activation, 10 mg/kg PJ34 (Selleck, Houston, TX, USA), a PARP inhibitor, was administered intraperitoneally daily for 10 d [13]. Control animals received an equivalent volume of vehicle (saline). For nuclear factor kappa B (Nfkb) knockdown, adeno-associated virus (AAV)-enveloped Nfkb (siNfkb) (siRNA sequence [5′ to 3′]: CGGATGACAGAGGCGTGTATT, Hanbio, Shanghai, China) was injected via the tail vein at a dose of 100 µL per mouse (1013 gc/mL). An equivalent volume of AAV-enveloped negative control (siControl) was injected via the tail vein of negative control mice. After treatment, the mice were euthanized, and their livers were either frozen in liquid nitrogen or fixed in 4% paraformaldehyde for subsequent biochemical and histological evaluations, respectively.

Behavioral analysis

Behavioral assessments were performed during the light phase of the light/dark cycle. Before each test, mice were acclimatized to the laboratory setting for a minimum of 30 min. Distinct behavioral examinations were performed with a 24-hour interval between each assessment.

Open-field test

Mice were positioned within the central area of the open-field arena, which was 50, 40, and 30 cm in length, width, and height, respectively. Mouse movement was monitored for 5 min using an automated video tracking system (XinRuan, Shanghai, China). Various parameters, such as the number of rearing instances and distance traveled, were subsequently analyzed to elucidate the specific trajectory of the mice.

Barnes maze test

Mice were subjected to a standardized experiment to assess memory. Initially, each mouse was carefully placed on a platform and guided to a shelter. Subsequently, the mice underwent a space acquisition phase for 4 consecutive days, during which they were granted unrestricted access to the test room for 3 min per day. Manual guidance was provided if the mice failed to reach the shelter during the allotted exploration period. On the fifth day, a probe test was conducted, in which the mice were allowed to freely navigate the maze while all entrances, including the one leading to the shelter, were sealed off. The Noldus Maze Video Tracking System (Noldus, Amsterdam, Netherlands) was used to measure the time taken by each mouse to reach the escape box. After each experiment, the platform and escape box were cleaned with 70% ethanol solution to eradicate any lingering odors.

Quantitative measurement of Cu2+ concentration

Cu2+ concentrations in the brain and other tissues were quantified using inductively coupled plasma mass spectrometry (PerkinElmer NEXION 350D; PerkinElmer, Waltham, MA, USA).

Microglia staining, confocal imaging, and image analysis

Brain tissues were fixed in 4% paraformaldehyde for 24 h, followed by immersion in a 30% sucrose solution for 2 days. The brains were then sectioned at a thickness of 30 μm and incubated overnight at 4 °C with a rabbit anti-ionized calcium-binding adaptor molecule 1 (Iba-1) antibody (1:100; Servicebio), followed by fluorochrome-conjugated secondary antibodies. Finally, all brain tissue samples were stained with DAPI (Servicebio) dilution buffer (1:2000) for 3 min, followed by two washes. DAPI was used to label the nuclei, and the sections were mounted using antifade mounting medium (Servicebio). Slide images were captured and examined under a microscope (Nikon, Tokyo, Japan) to quantify microglial density. The number of ionized calcium-binding adaptor molecule 1 (Iba1)-positive cells was quantified at a magnification of 20×. Two randomly selected slices per mouse were imaged and quantified, with six mice per group. Subsequently, cell counting and colocalization analyses were performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA) by an observer blinded to the experimental conditions [14].

For 3D reconstruction of microglia, fluorescent images were acquired using a Nikon Confocal Eclipse C1 microscope (Nikon, Japan) at 60× magnification. Z stacking was captured with 1.5 μm intervals on the Z-axis, and images with a resolution of 1024 × 1024 pixels were processed using IMARIS 9.9.0 software (Bitplane, Schlieren, Switzerland).

Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR)

Total RNA was isolated from the brain and other tissues using an Easy Tissue/Cell RNA Kit (Sparkjade Biotechnology, Shandong, China), following the manufacturer’s instructions. cDNA was synthesized using the Script II RT Plus Kit (Sparkjade Biotechnology). Quantitative real-time qRT-PCR was performed using a StepOnePlus Real-Time PCR System (Applied Biosystems, Darmstadt, Germany). Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was used as an internal control. Primer sequences are listed in Additional file 1 (Table S1).

Western blotting

Protein lysates were prepared using radioimmunoprecipitation assay (RIPA) buffer (Solarbio) supplemented with a protease- and phosphatase-inhibitor cocktail (Solarbio). Subsequently, approximately 20–30 µg of the extracted protein was separated using a 10–15% SDS-polyacrylamide gel, electroblotted onto a 0.2-µm NC-membrane (GE Healthcare Life Sciences, Pittsburgh, PA, USA), and blocked with a commercial blocking buffer (Beyotime, Shanghai, China). Membranes were incubated with primary rabbit anti-CP (1:1000; Proteintech, Wuhan, China), rabbit anti-ATP7B (1:5000; Proteintech), and mouse anti-GAPDH (control) antibodies overnight, followed by horseradish peroxidase (HRP)-conjugated secondary antibodies (Servicebio, Wuhan, China). The signal was developed using enhanced chemiluminescence (ECL, Thermo Fisher Scientific, Waltham, MA, USA) and detected using a Gel Imaging System (Thermo Fisher Scientific).

Immunohistochemistry and immunofluorescent staining

Immunohistochemistry and immunofluorescence staining were performed as previously described [15, 16]. Briefly, mouse tissues were transcardially perfused with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde solution overnight. Liver tissues were then sectioned at a thickness of 4 μm and blocked with 3% bovine serum albumin solution for 30 min. Subsequently, the sections were incubated with primary rabbit anti-myeloperoxidase (MPO) (1:100; Servicebio), rabbit anti-lymphocyte antigen 6G (Ly6G) (1:100; Servicebio), rabbit anti-CD20 (1:100; Servicebio), rabbit anti-CD11b (1:100; Servicebio), rabbit anti-CD4 (1:100; Servicebio), rabbit anti-CD8 (1:100; Servicebio), and rabbit anti-glial fibrillary acidic protein (GFAP) (1:100; Servicebio) antibodies at 4 °C overnight. The sections were rinsed with PBS and incubated with HRP or fluorescent-labeled secondary antibodies to visualize infiltrated immune cells. The number of cells was quantified using a BX53 microscope (Olympus, Tokyo, Japan). Quantitative immunofluorescence analysis was performed using the ImageJ software (National Institutes of Health, Bethesda, MD, USA).

TUNEL staining

Apoptotic neuronal cells were quantified using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining (Servicebio) according to the manufacturer’s instructions. The samples were observed by a skilled pathologist who was blinded to the experimental conditions, using an ortho-fluorescent microscope, and TUNEL-positive cells were evaluated.

Histopathological staining

Mice were transcardially perfused with PBS. Tissues were post-fixed with a 4% paraformaldehyde solution overnight and subsequently embedded in paraffin. Tissue blocks were further sectioned and stained with hematoxylin and eosin, and histopathological lesions were scored as previously described [17]. To quantify the level of fibrosis, liver sections were deparaffinized and stained with potassium dichromate solution overnight and iron hematoxylin for 3 min. Subsequently, the sections were washed and stained with Ponceau acid fuchsin solution. The sections were washed twice and stained with an aniline blue solution for 3–6 min. Finally, the sections were dehydrated using ethanol and xylene solutions and mounted under a coverslip with resin. Hepatic collagen deposition was quantified as previously described [18]. All scoring and quantification were performed in a double-blinded manner on the coded slides.

Biochemical assays

Blood samples were collected from the abdominal aorta. Serum was separated by centrifugation at 3500 rpm at 4 °C. CP concentrations were quantified using a commercial enzyme-linked immunosorbent assay kit (Solarbio, Shanghai, China) according to the manufacturer’s instructions. Serum levels of inflammatory cytokines IL-1β, IL-18, tumor necrosis factor (TNF), and IL-6 (Multi Sciences, Zhejiang, China) were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits in accordance with the manufacturer’s instructions. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were quantified using a Roche Hitachi C311 Chemistry Analyzer (Roche Diagnostics, Basel, Switzerland).

Statistical analyses

Statistical analyses were performed using GraphPad Prism, version 9 (GraphPad Software, San Diego, CA, USA). The data are presented as the mean ± standard error of the mean. Single-variant analyses were performed using independent-sample t-tests. Two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test was used to compare means among multiple groups. Statistical significance was set at P < 0.05.

Results

Arg778Leu mutation results in early onset of behavioral abnormalities in the brain

In clinical settings, the Arg778Leu mutation in exon 8 is frequently detected in patients with more severe WD [19]. To elucidate the mechanisms governing WD progression, the Arg778Leu mutation was deliberately introduced into mice (R778L mice) using CRISPR/Cas9 technology to establish a mouse model harboring this mutation (Additional file 1: Fig. S1). As neurological manifestations are common clinical signs in individuals with WD, we first compared the neurological phenotypes of the R778L and tx-j mice (Fig. 1A). The exercise distance and number of climbs of R778L mice were significantly lower than those of WT C57BL/6J mice beginning at 3 months of age (Fig. 1B). In contrast, the exercise distance and number of climbs of tx-j mice were significantly lower than those of WT C3H mice starting from the age of 5 months (Fig. 1B). In terms of time spent in the central zone, R778L mice, but not tx-j mice, spent significantly less time in the central zone than their WT counterparts (Fig. 1B). The target hole escape time of R778L mice differed significantly from that of WT C57BL/6J mice starting at 3 months of age. However, tx-j mice only exhibited this difference at 5 months of age (Fig. 1C). These results indicate that, compared with tx-j mice, R778L mice exhibited an earlier onset of behavioral abnormalities.

Fig. 1
figure 1

Cognitive and locomotor behavior decline in R778L mice. (A) Schematic of the experimental setup. (B) Total distance, climbing behavior, and time spent in the center of the R778L and tx-j mice were quantified using the open-field test (n = 5–12 per group). (C) Escape latencies of R778L and tx-j mice were measured using the Barnes maze test (n = 5–12 per group). (D) Cu2+ content in the striatum and hippocampus of R778L and tx-j mice was determined using inductively coupled plasma mass spectrometry (ICP-MS) (n = 6 per group). (E) Cu2+ content in the cortex, cerebellum, and brainstem of R778L and tx-j mice determined by inductively coupled plasma mass spectrometry (ICP-MS) (n = 6 per group). The data are presented as mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the corresponding wild-type (WT) mice

Full size image

After determining the neurological phenotypes of R778L mice, we examined Cu2+ levels in various organs and tissues. Interestingly, our findings revealed that the Cu2+ concentrations in the striatum, hippocampus, cortex, cerebellum, and brainstem were comparable between R778L mice and their WT C57BL/6J counterparts. Conversely, a different pattern was observed in tx-j mice. At 5 months of age, Cu2+ levels in various brain regions of tx-j mice were significantly higher than those in WT C3H mice (Fig. 1D, E). Moreover, the iron concentrations in the liver and brain tissues of 5-month-old tx-j mice were significantly elevated compared with those in WT C3H mice. In contrast, no significant differences were noted between R778L and WT C57BL/6J mice. (Additional file 1: Fig. S2A–F).

Altogether, despite the behavioral abnormalities observed in R778L mice, the missense mutation of R778L in Atp7b did not significantly affect copper metabolism in the brain, and different genetic mutations may lead to distinct disease phenotypes and progression patterns.

Mice carrying the Arg778Leu mutation show inflammation-related alterations in microglia

Previous reports of WD models have demonstrated the presence of mild inflammation in the brain [20]. We examined the levels of pro-inflammatory cytokines in the brains of WD mice. We found significantly elevated levels of tumor necrosis factor (Tnf) in adult R778L mice compared with WT C57BL/6J mice (Fig. 2A). In contrast, tx-j mice exhibited increased levels of inflammatory cytokines (Tnf, Il1b, Il6, and Il18) starting at 5 months of age (Fig. 2A–D). In addition, elevated levels of TNF, IL-1β, IL-6, and IL-18 were observed in serum samples of 3- and 5-month-old R778L mice and 5-month-old tx-j mice compared with those in WT mice (Additional file 1: Fig. S3). Subsequently, we examined potential alterations in microglial morphology and density within the cortex and striatum of these mice. A significant increase in the number of Iba1-positive microglia, along with Iba1 intensity, was observed in both the striatum and cortex of R778L mice at 3 and 5 months of age, whereas these notable changes were also detected in tx-j mice at 5 months of age (Fig. 3A, B; Additional file 1: Fig. S4A, B). Morphological analysis of microglia revealed significantly shorter processes and reduced branch points in the striatum and cortex of 3- and 5-month-old R778L mice. However, tx-j mice only exhibited these phenotypes at 5 months of age (Fig. 3C–E; Additional file 1: Fig. S4C–E). In addition, significantly larger soma areas were observed in these regions of 3- and 5-month-old R778L mice and 5-month-old tx-j mice (Fig. 3E, Additional file 1: Fig. S4E). These findings suggest that microglial morphology is altered in an age- and genotype-dependent manner. The striatum of 3- and 5-month-old R778L mice exhibited responsive astrocytes, which were detected by a slight increase in the number of GFAP-positive cells compared with that in WT C57BL/6J mice. As with microglia, the number of astrocytes was slightly higher in 5-month-old tx-j mice than in 5-month-old WT C3H mice (Additional file 1: Fig. S5).

Fig. 2
figure 2

Levels of inflammatory markers in the brains of R778L mice increased over time. (A) mRNA levels of Tnf in the striatum, hippocampus, and cortex of R778L and tx-j mice (n = 3–7 per group). (B) Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) analysis of the mRNA expression of Il1b in the striatum, hippocampus, and cortex of R778L and tx-j mice (n = 3–7 per group). (C) Expression of Il6 in the striatum, hippocampus, and cortex of R778L and tx-j mice was analyzed at the mRNA level using qRT-PCR (n = 3–7 per group). (D) mRNA levels of Il18 in the striatum, hippocampus, and cortex of R778L and tx-j mice (n = 3–7 per group). The data are presented as mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the corresponding wild-type (WT) mice

Full size image
Fig. 3
figure 3

Early activation of microglia in R778L mice. (A) Brain slices obtained from the striatal regions of wild-type (WT) and Wilson’s disease (WD) mice were stained with anti-ionized calcium-binding adaptor molecule 1 (Iba1) antibodies to visualize microglia. Scale bar = 50 μm. (B) Quantification of Iba1-positive cells and cell density per unit area in the striata of R778L and tx-j mice (n = 6 per group). (C) 3D reconstruction of microglia from wild-type (WT) and Wilson disease (WD) mice using the Imaris v.9.9.0 software (n = 6 per group). Scale bar = 5 μm. (D) Quantification of microglial processes in the striatum of R778L and tx-j mice by Sholl analysis (n = 6 per group). (E) Quantification of the total process length, process branch points per cell, and soma size of Iba1-positive microglia in the striatum of R778L and tx-j mice (n = 6 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, *** p < 0.001 versus the corresponding wild-type (WT) mice

Full size image

Overall, compared with tx-j mice, R778L mice developed significant microglial activation and neuroinflammation at an early age.

Arg778Leu mutation leads to hepatic Cu2+ deposition and liver inflammation

Pathophysiological comparisons were performed using R778L transgenic mice and comparative analysis of the established tx-j mouse model. Notably, the livers of R778L mice exhibited a notable reduction in Atp7b mRNA transcription compared with WT C57BL/6J mice (Additional file 1: Fig. S6A). In parallel, ATP7B protein levels in the liver of R778L mice were significantly lower than those in WT C57BL/6J mice (Additional file 1: Fig. S6B). Conversely, tx-j mice showed no significant difference in the levels of either Atp7b mRNA or ATP7B protein compared with WT C3H mice (Additional file 1: Fig. S6A, B). Serum CP levels in both R778L and tx-j mice were significantly lower than those in WT control mice (Additional file 1: Fig. S6C), whereas holo-CP levels in the livers of R778L mice, but not in tx-j mice, were significantly lower than those in the livers of WT control mice (Additional file 1: Fig. S6D). Specifically, the concentration of non-CP-bound Cu2+ in the serum of adult R778L mice was approximately eight times higher than that in the serum of WT C57BL/6J mice (Additional file 1: Fig. S6E). Furthermore, urinary Cu2+ levels in R778L and tx-j mice were significantly higher than those in WT control mice, whereas fecal Cu2+ levels in R778L and tx-j mice did not differ significantly from those in WT mice (Additional file 1: Fig. S6E). These results indicate that the R778L mutation within the Atp7b gene impairs the physiological excretion of bile Cu2+, thereby causing significant disturbances in copper metabolism in R778L mice.

Given that Cu2+ overload in the liver is a hallmark of WD, we quantified Cu2+ levels in liver tissues of WD and WT mice. Cu2+ levels in the liver tissues of R778L and tx-j mice were significantly higher than those in WT control mice at 3 and 5 months of age (Fig. 4A). In addition, plasma ALT and AST levels in adult R778L and tx-j mice were significantly higher than those in control mice (Fig. 4B). At 3 months of age, R778L and tx-j mice exhibited pronounced edema, degeneration of the liver tissue surrounding the central vein, and cytoplasmic loosening (Fig. 4C, D). The hepatocytes of 5-month-old R778L and tx-j mice exhibited signs of swelling and an increased severity of chromatin edges. Notably, the liver lobules and interstitium of R778L mice showed marked inflammatory cell infiltration, whereas inflammatory cell infiltration in the liver was limited in tx-j mice (Fig. 4C, E). Notably, the numbers of MPO-positive cells in the livers of 3- and 5-month-old R778L mice was significantly higher than that in WT C57BL/6J mice (Fig. 5A, B). However, 5-month-old tx-j mice exhibited limited neutrophil infiltration (Fig. 5A, B). Additionally, in 3- and 5-month-old R778L mice, the number of T lymphocytes and the CD4-positive/CD8-positive T cell ratio was significantly lower than those in WT C57BL/6J mice (Additional file 1: Fig. S7A-D), whereas the numbers of CD20-positive and CD11b-positive cells were significantly higher in R778L mice than in WT C57BL/6J mice (Additional file 1: Fig. S8A-D). Our study revealed that 5-month-old tx-j mice exhibited a significantly lower ratio of liver CD4-positive/CD8-positive T cells than 5-month-old WT C3H mice (Additional file 1: Fig. S7A-D), whereas the numbers of CD20-positive and CD11b-positive cells were significantly higher in tx-j mice than in WT C3H mice (Additional file 1: Fig. S8A-D). However, these differences were not statistically significant in the 3-month-old tx-j and WT C3H counterparts. Furthermore, the hepatic tissue of adult R778L mice exhibited significantly elevated mRNA levels of inflammatory markers, such as Tnf, Il1b, Il6, Il18, chemokine ligand 2 (Ccl2), nitric oxide synthase 2 (Nos2), and Cd68, compared with those of WT C57BL/6J mice (Fig. 5C-E). In contrast, the mRNA levels of Il6, Ccl2, and Nos2 in the livers of tx-j mice did not differ significantly from those in WT C3H mice (Fig. 5C-E). In contrast to the R778L mice, tx-j mice exhibited slight differences in Tnf, Il1b, Il18, and Cd68 expression at 5 months of age (Fig. 5C-E).

Fig. 4
figure 4

Development of liver injury in Wilson’s disease (WD) mice over time. (A) Hepatic Cu2+ content in R778L and tx-j mice was determined using inductively coupled plasma mass spectrometry (ICP-MS) (n = 6 per group). (B) Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels (U/mL) measured in the serum samples of R778L and tx-j mice at 1, 3, and 5 months of age (n = 6–8 per group). (C) Representative images of hematoxylin and eosin stained liver sections from R778L and tx-j mice. (D) Hepatocyte ballooning scores in the livers of R778L and tx-j mice (n = 6 per group). (E) Inflammation scores in the liver of R778L and tx-j mice (n = 6 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by the Tukey multiple comparisons test. * p < 0.05, *** p < 0.001 versus the corresponding wild-type (WT) mice

Full size image
Fig. 5
figure 5

Increased inflammation in the livers of Wilson’s disease (WD) mice. (A) Immunohistochemical detection of myeloperoxidase-positive (MPO) positive cells in the livers of R778L and tx-j mice. (B) MPO-positive cells per field in the livers of R778L and tx-j mice (n = 6 per group). (C and D) Hepatic expression of genes involved in hepatic inflammation (Tnf, Il1b, Il6, and Il18) was analyzed in R778L and tx-j mice using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) (n = 5–7 per group). (E) qRT-PCR analysis of Ccl2, Nos2, and Cd68 mRNA expression in the livers of WD mice (n = 5–7 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, *** p < 0.001 versus the corresponding wild-type (WT) mice

Full size image

These results suggest that the presence of the R778L mutation leads to hepatic Cu2+ deposition and liver inflammation, resulting in an earlier onset of liver fibrosis in R778L mice than in tx-j mice.

R778L mice exhibited multifocal fibrosis in the liver

Chronic inflammation is a major cause of hepatic fibrosis. R778L mice exhibited focal or multifocal periportal fibrosis in the liver at 3 months. By 5 months of age, these pathological changes progressed to diffuse bridging fibrosis, accompanied by structural deterioration. In contrast, mild fibrosis was observed around the liver portal area in 3-month-old tx-j mice (Additional file 1: Fig. S9A). As the disease progressed, the fibrotic region surrounding the portal area continued to expand and fibrosis emerged in the liver lobules by 5 months of age (Additional file 1: Fig. S9A, B). Furthermore, in both 3-month-old and 5-month-old R778L mice, the mRNA expression levels of fibrotic markers, such as Tgfb, Col1a1, Timp1, and Acta2, were notably elevated compared with those of WT C57BL/6J mice (Additional file 1: Fig. S9C, D). Significantly higher levels of liver Col1a1 and Acta2 were also observed in 5-month-old tx-j mice than in WT C3H mice (Additional file 1: Fig. S9D). Furthermore, compared with their respective WT control mice, R778L mice aged 3 and 5 months and tx-j mice had elevated serum levels of collagen IV, hepcidin III, laminin, and hyaluronic acid (Additional file 1: Fig. S9E, F). These results suggest severe hepatic fibrosis in R778L mice compared with that in tx-j mice.

Suppressing liver inflammation improves behavioral abnormalities in R778L mice

The observation that the Arg778Leu mutation enhanced the Cu2+ concentration in the liver but not in the brain suggests that WD is likely associated with altered copper metabolism in the liver rather than in the brain. The livers of the R778L mice exhibited higher levels of inflammation (Fig. 5). The levels of Tnf expression in the brains of R778L mice were significantly higher than those of WT C57BL/6J mice (Fig. 2). Additionally, microglia in the brains of R778L mice were significantly activated at 3 and 5 months of age (Fig. 3). This led us to hypothesize the presence of liver-brain crosstalk in inflammation, which could play a key role in the development of motor and cognitive impairments observed in R778L mice. We tested this hypothesis by treating R778L mice with PJ34, a PARP inhibitor. We observed a notable reduction in PARP activation (Additional file 1: Fig. S10A) and decreased neutrophil infiltration (Fig. 6A, B, and Additional file 1: Fig. S10B) and the expression levels of inflammatory factors in the livers of R778L mice (Fig. 6C, Additional file 1: Fig. S10C). PJ34 treatment significantly inhibited the number and intensity of Iba-1 positive cells and mRNA levels of Tnf in the brains of R778L mice (Fig. 7A–C). In terms of behavioral performance, R778L mice exhibited shorter exercise distances and fewer climbs than WT (C57BL/6J) mice. However, upon PJ34 administration, the exercise distance and number of climbs significantly increased and the escape time in the Barnes maze decreased in R778L mice (Fig. 7D-F).

Fig. 6
figure 6

Pharmacological inhibition of poly (ADP-ribose) polymerase (PARP) with PJ34 attenuates liver inflammation in R778L mice. (A) Representative image showing immunofluorescence staining for Ly6G in the livers of R778L and wild-type (WT) mice following PJ34 or vehicle treatment. (B) Quantification of lymphocyte antigen 6G (Ly6G)-positive cells per field in the livers of R778L and WT mice following PJ34 or vehicle treatment (n = 6–8 per group). (C) Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) analysis of Tnf, Il1b, and Il66 mRNA expression in livers of R778L and WT mice following PJ34 or vehicle treatment (n = 5–9 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. *** p < 0.001 versus the mice treated with vehicle

Full size image
Fig. 7
figure 7

Pharmacological inhibition of poly (ADP-ribose) polymerase (PARP) with PJ34 improves locomotor performance in R778L mice. (A) Representative image of ionized calcium-binding adaptor molecule 1 (Iba1) staining in the brain. (B) Quantification of Iba1-positive cells and cell density per field in the striata of R778L and WT mice after PJ34 or vehicle treatment (n = 6 per group). (C) mRNA levels of Tnf in the striatum of R778L and WT mice following PJ34 or vehicle treatment (n = 6–8 per group). (D and E) The measurement of total distance, climbing behavior, and time spent in the center of R778L and WT mice following PJ34 or vehicle treatment, as assessed using the open-field test (n = 10 per group). (F) Escape latency in mice subjected to the Barnes maze test (n = 10 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, *** p < 0.001 versus the mice treated with vehicle

Full size image

To further elucidate the involvement of inflammation in the development of neurological manifestations, the liver-specific siNfkb (Fig. 8A) was administered to R778L mice. Administration of siNfkb significantly reduced Nfkb mRNA levels in the liver of R778L mice (Additional file 1: Fig. S11A). Moreover, the cell death levels did not differ significantly according to the treatment type (Additional file 1: Fig. S11B and C). Treatment with siNfkb significantly improved cognitive performance and locomotor activity in the R778L mice (Fig. 8B, C). Moreover, it attenuated neutrophil infiltration and inflammatory cytokine expression (Fig. 8D–F and Additional file 1: Fig. S11D, E). Additionally, the expression of Tnf mRNA was inhibited in the liver and striatum of Nfkb-knockout mice (Fig. 8F). Taken together, blocking liver inflammation with PJ34 or liver-specific silencing of siNfkb suppressed hepatic inflammation and protected the R778L mice against progressive motor deficits and cognitive decline (Fig. 9).

Fig. 8
figure 8

Hepatic Nfkb deficiency alleviates cognitive performance and improves locomotor activity in R778L mice. (A) Schematic representation of experimental setup. (B) Measurement of total distance, climbing behavior, and time spent in the center of R778L and wild-type (WT) mice injected with siControl or siNfkb, assessed using the open-field test (n = 7–8 per group). (C) Escape latency in mice subjected to the Barnes maze test (n = 7–8 per group). (D) Representative image showing immunofluorescence staining for Ly6G in the livers of R778L and WT mice injected with siControl or siNfkb. (E) Quantification of Ly6G-positive cells per field in livers of R778L and WT mice injected with siControl or siNfkb (n = 6–8 per group). (F) Quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) analysis of Tnf mRNA expression in the liver and striatum of R778L and WT mice injected with siControl or siNfkb (n = 7–9 per group). The data are presented as the mean ± SEM and were evaluated using two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the mice treated with vehicle

Full size image
Fig. 9
figure 9

Liver-brain axis in R778L mice. Impairment of biliary copper excretion in R778L mice results in progressive accumulation of copper within the liver. This copper accumulation triggers the activation of stress-signaling pathways, including NF-κB, which subsequently leads to inflammatory changes, specifically hepatitis, and the overall accumulation of the extracellular matrix, known as fibrosis, within the liver. Hepatic inflammation further promotes systemic inflammation, which in turn activates microglia and increases the production of pro-inflammatory cytokines, ultimately resulting in neuroinflammation

Full size image

Discussion

The findings from this study provide novel evidence that the neurological manifestations observed in patients with WD are attributable to Cu2+ accumulation within the brain and inflammation outside the brain, particularly in the liver, which subsequently affects the central nervous system (CNS) via the liver-brain axis. The study also revealed that R778L mice could serve as a useful animal model for investigating the molecular mechanisms underlying liver and neuropathology in WD, as well as for evaluating the effectiveness of potential therapeutic strategies for WD in humans.

Although initial neurological symptoms and signs can be present in 18–68% of individuals with WD, they typically manifest later than those of liver disease. Neurological manifestations are characterized primarily by various types of movement disorders [5]. Tremor, dystonia, choreoathetosis, gait disorders, and other involuntary movements are the most frequently observed movement disorders in individuals with WD [21,22,23]. Furthermore, individuals with WD often exhibit a range of neurological manifestations beyond the typical movement disorders associated with the condition, including epilepsy, olfactory dysfunction, copper-deficiency peripheral neuropathy, restless legs syndrome, and rapid eye movement (REM) sleep behavior disorder [23,24,25]. Additionally, psychiatric disorders and cognitive impairments have been observed in these patients [26]. Although neurological symptoms occur less frequently and at a later stage than liver disease in WD, the potential mechanistic connection between these two conditions remains unclear.

Previously, Atp7b−/− and tx-j mice were used to investigate WD. Both strains of mice display Cu2+ overload in the liver, closely mimicking copper metabolism disorders in individuals with WD [8, 10, 27]. In Atp7b−/− mice, hepatic pathological changes are evident, beginning with early alterations in ultrastructure, lipid degeneration, and mild inflammation at 6 weeks of age, and progressing to late-stage hepatitis, developmental abnormalities, and necrotizing inflammation between 12 and 20 weeks of age. Conversely, the hepatic histology of tx-j mice remains predominantly normal until they reach 3–4 months of age, after which hepatocyte nuclei enlargement becomes apparent. In tx-j mice aged ≥ 5 months, a significant increase in inflammatory cell infiltration was observed in the liver, accompanied by mild microvesicular steatosis. However, Atp7b−/− mice do not exhibit notable neurobehavioral alterations or pathological brain damage. In contrast, tx-j mice develop neurological manifestations that differ from those observed in humans with WD [8]. In addition, the Arg778Leu mutation in exon 8 is a prevalent genetic variant among individuals with WD [2, 28]. Neither Atp7b−/− mice nor tx-j mice harbor this mutation. This limits their ability to fully replicate the genetic mutations observed in humans with WD. In contrast, the R778L mice generated in this study had the same mutation as individuals harboring the Arg778Leu mutation. Moreover, R778L mice exhibit liver Cu2+ overload and deficits in motor coordination and cognitive dysfunction, making R778L mice a valuable model for studying WD.

Individuals harboring protein-truncating mutations exhibit earlier disease onset due to reduced ATP7B protein levels [29, 30]. Arg778, situated in the second metal-binding domain, is close to the cytoplasmic copper-binding site Met729 and forms a salt bridge with Asp730 in the first metal-binding domain [31, 32]. This interaction may contribute to stabilizing the transmembrane domain conformation in a state of high affinity for copper. The p.R778L mutation disrupts the salt bridge, leading to reduced transport activity and severe phenotypes [32]. The onset of clinical manifestations occurs early in individuals with WD caused by R778L mutation. It is characterized by more severe damage and inflammation in liver tissue than in individuals with WD caused by other mutations [19]. However, specific genetic mutations, such as p.R992L and E1064A, can partially sustain the copper transport capability of ATP7B, potentially reducing the severity of the clinical manifestations of ATP7B deficiency [33, 34]. Consistent with these observations, R778L mutant mice displayed an earlier onset of clinical manifestations of WD than tx-j mice and displayed a more pronounced phenotype. This discrepancy could be attributed to the substitution of positively charged arginine with a larger and more hydrophobic leucine, which is likely to have a more detrimental effect on the conformational function of the protein than that caused by the replacement of glycine with threonine.

Brain tissue samples obtained from patients with neurological phenotypes of WD demonstrated elevated levels of Cu2+ in the brain [7, 35]. Furthermore, middle-aged and older tx-j mice demonstrated significantly elevated Cu2+ levels in various cerebral regions compared with control mice. These changes are accompanied by behavioral abnormalities, suggesting that the neurological phenotypes in individuals with WD may be linked to Cu2+ accumulation in the CNS. However, not all individuals with WD with elevated Cu2+ levels in the brain tissue exhibit significant neurological manifestations [36]. This suggests that the neurological symptoms of WD are complex and may involve multiple factors in addition to Cu2+ accumulation. Furthermore, in R778L mice, the onset of neurological manifestations occurred significantly earlier than the increase in Cu2+ concentration in brain tissue. Moreover, R778L mice exhibited neurological signs in adulthood; however, the Cu2+ and Fe2+ levels in their brains did not differ significantly from those of WT C57BL/6J mice. These results indicate that the neurological manifestations of R778L mice occur independently of the deposition of Cu2+ ions in the CNS. Therefore, although the neurological manifestations observed in individuals with WD can be accompanied by increased Cu2+ concentrations in the brain, they are likely not attributable to the accumulation of Cu2+ in the brain in some WD phenotypes.

A major finding of this study was that inhibition of liver inflammation improved neurological disorders in R778L mice. This suggests that the neurological manifestations are attributable to copper-related liver inflammation and demonstrate liver-brain crosstalk in the context of inflammation. In hepatic encephalopathy, liver-derived cytokines can traverse the intact blood-brain barrier, subsequently activating endothelial cells and transmitting signals to perivascular macrophages [37, 38]. This cascade of events can lead to microglial activation, and subsequently induce the onset of neurological manifestations. This probably explains why adult R778L mice exhibited mild glial cell activation in their brains, accompanied by elevated levels of inflammatory factors in the CNS. The blockade of hepatic inflammation likely attenuated glial cell activation in the brains of R778L mice, thereby ameliorating their behavioral abnormalities. However, the mechanism by which Cu2+ overload in the liver causes neuroinflammation remains unclear.

Previous studies have shown that the copper transporter ATP7B is essential for normal cerebral uptake of Cu2+ [39]. Disruption of ATP7B function induces reorganization of the cytoskeleton within the choroid plexus, thereby affecting the activity of the copper transporters ATP7a and Slc31a [40]. Consequently, ATP7a fails to effectively transport Cu2+ into the cerebrospinal fluid, resulting in a temporary deficiency of Cu2+ within the brain and a subsequent imbalance in catecholamine and lipid levels. This study substantiates these findings by demonstrating a significant reduction in Cu2+ levels in the brains of 1-month-old R778L mice compared with their WT counterparts. Hence, it is plausible that the neurological manifestations observed in R778L mice were associated with an initial decline in cerebral Cu2+ levels. Further investigation is required to elucidate the precise underlying pathological mechanisms.

In summary, we generated an Atp7b mutant mouse model and elucidated the pathogenesis of a copper metabolism disorder induced by the R778L point mutation, successfully replicating the neurological phenotype of humans with WD in mice. This novel mouse model provides a powerful tool for studying WD pathogenesis. We demonstrated that blocking hepatic inflammation effectively reduces the neurological manifestations exhibited in WD model animals, indicating that liver inflammation and damage are an integral part of the pathogenic mechanism underlying the neurological phenotypes observed in individuals with WD, suggesting a potential therapeutic strategy for WD neurological disorders through the inhibition of liver inflammation.

Data availability

No datasets were generated or analysed during the current study.

Abbreviations

AAV:

Adeno-associated virus

ALT:

Alanine aminotransferase

ANOVA:

Analysis of variance

AST:

Aspartate aminotransferase

ATP7B:

P-type copper-transporting ATPase

Ccl2:

Chemokine ligand 2

CNS:

Central nervous system

CP:

Ceruloplasmin

GAPDH:

Glyceraldehyde 3-phosphate dehydrogenase

HRP:

Horseradish peroxidase

IL-1β:

Interleukin-1 beta

NF-κB:

Nuclear factor kappa B

Nos2:

Nitric oxide synthase 2

PARP:

Poly (ADP-ribose) polymerase

PBS:

Phosphate-buffered saline

qRT-PCR:

Quantitative real-time reverse-transcription polymerase chain reaction

R778L:

Arg778Leu mutation

RIPA:

Radioimmunoprecipitation assay

sgRNA:

Single guide RNA

Tnf:

Tumor necrosis factor

tx-j:

Jackson toxic milk

WD:

Wilson’s disease

WT:

Wild-type

References

  1. Aggarwal A, Bhatt M. Wilson disease. Curr Opin Neurol. 2020;33(4):534–42.

    Article  PubMed  Google Scholar 

  2. Cheng N, Wang H, Wu W, Yang R, Liu L, Han Y, et al. Spectrum of ATP7B mutations and genotype-phenotype correlation in large-scale Chinese patients with Wilson Disease. Clin Genet. 2017;92(1):69–79.

    Article  CAS  PubMed  Google Scholar 

  3. Thomas GR, Forbes JR, Roberts EA, Walshe JM, Cox DW. The Wilson disease gene: spectrum of mutations and their consequences. Nat Genet. 1995;9(2):210–7.

    Article  CAS  PubMed  Google Scholar 

  4. Nagral A, Mallakmir S, Garg N, Tiwari K, Masih S, Nagral N, et al. Genomic variations in ATP7B Gene in Indian patients with Wilson Disease. Indian J Pediatr. 2023;90(3):240–8.

    Article  PubMed  Google Scholar 

  5. Członkowska A, Litwin T, Dusek P, Ferenci P, Lutsenko S, Medici V, et al. Wilson disease. Nat Rev Dis Primers. 2018;4(1):21.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Mohr I, Pfeiffenberger J, Eker E, Merle U, Poujois A, Ala A, Weiss KH. Neurological worsening in Wilson disease - clinical classification and outcome. J Hepatol. 2023;79(2):321–8.

    Article  CAS  PubMed  Google Scholar 

  7. Litwin T, Gromadzka G, Szpak GM, Jabłonka-Salach K, Bulska E, Członkowska A. Brain metal accumulation in Wilson’s disease. J Neurol Sci. 2013;329(1–2):55–8.

    Article  CAS  PubMed  Google Scholar 

  8. Reed E, Lutsenko S, Bandmann O. Animal models of Wilson disease. J Neurochem. 2018;146(4):356–73.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Wooton-Kee CR, Robertson M, Zhou Y, Dong B, Sun Z, Kim KH, et al. Metabolic dysregulation in the Atp7b(-/-) Wilson’s disease mouse model. Proc Natl Acad Sci U S A. 2020;117(4):2076–83.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Lutsenko S. Atp7b-/- mice as a model for studies of Wilson’s disease. Biochem Soc Trans. 2008;36(Pt 6):1233–8.

    Article  CAS  PubMed  Google Scholar 

  11. Le A, Shibata NM, French SW, Kim K, Kharbanda KK, Islam MS, et al. Characterization of timed changes in hepatic copper concentrations, methionine metabolism, gene expression, and global DNA methylation in the Jackson toxic milk mouse model of Wilson disease. Int J Mol Sci. 2014;15(5):8004–23.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Przybyłkowski A, Gromadzka G, Wawer A, Bulska E, Jabłonka-Salach K, Grygorowicz T, et al. Neurochemical and behavioral characteristics of toxic milk mice: an animal model of Wilson’s disease. Neurochem Res. 2013;38(10):2037–45.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Mukhopadhyay P, Horváth B, Rajesh M, Varga ZV, Gariani K, Ryu D, et al. PARP inhibition protects against alcoholic and non-alcoholic steatohepatitis. J Hepatol. 2017;66(3):589–600.

    Article  CAS  PubMed  Google Scholar 

  14. Jensen EC. Quantitative analysis of histological staining and fluorescence using ImageJ. Anat Rec (Hoboken). 2013;296(3):378–81.

    Article  PubMed  Google Scholar 

  15. Cao K, Liao X, Lu J, Yao S, Wu F, Zhu X, et al. IL-33/ST2 plays a critical role in endothelial cell activation and microglia-mediated neuroinflammation modulation. J Neuroinflammation. 2018;15(1):136.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Wu F, Zou Q, Ding X, Shi D, Zhu X, Hu W, et al. Complement component C3a plays a critical role in endothelial activation and leukocyte recruitment into the brain. J Neuroinflammation. 2016;13:23.

    Article  PubMed  PubMed Central  Google Scholar 

  17. Greig JA, Nordin JML, Smith MK, Ashley SN, Draper C, Zhu Y, et al. A Gene Therapy Approach To Improve Copper Metabolism and prevent liver damage in a mouse model of Wilson Disease. Hum Gene Ther Clin Dev. 2019;30(1):29–39.

    Article  CAS  PubMed  Google Scholar 

  18. Murillo O, Moreno D, Gazquez C, Barberia M, Cenzano I, Navarro I, et al. Liver expression of a MiniATP7B gene results in long-term restoration of copper homeostasis in a Wilson Disease Model in mice. Hepatology. 2019;70(1):108–26.

    Article  CAS  PubMed  Google Scholar 

  19. Wu ZY, Lin MT, Murong SX, Wang N. Molecular diagnosis and prophylactic therapy for presymptomatic Chinese patients with Wilson disease. Arch Neurol. 2003;60(5):737–41.

    Article  PubMed  Google Scholar 

  20. Dong J, Wang X, Xu C, Gao M, Wang S, Zhang J, et al. Inhibiting NLRP3 inflammasome activation prevents copper-induced neuropathology in a murine model of Wilson’s disease. Cell Death Dis. 2021;12(1):87.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Lucena-Valera A, Ruz-Zafra P, Ampuero J. Wilson’s disease: overview. Med Clin (Barc). 2023;160(6):261–7.

    Article  CAS  PubMed  Google Scholar 

  22. Bandmann O, Weiss KH, Kaler SG. Wilson’s disease and other neurological copper disorders. Lancet Neurol. 2015;14(1):103–13.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Lorincz MT. Neurologic Wilson’s disease. Ann N Y Acad Sci. 2010;1184:173–87.

    Article  CAS  PubMed  Google Scholar 

  24. De Cochen V, Lacombe S, Woimant F, Poujois A. Sleep disorders in Wilson’s disease. Sleep Med. 2021;83:299–303.

    Article  Google Scholar 

  25. Chen L, Wang X, Doty RL, Cao S, Yang J, Sun F, Yan X. Olfactory impairment in Wilson’s disease. Brain Behav. 2021;11(3):e02022.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Litwin T, Dusek P, Szafrański T, Dzieżyc K, Członkowska A, Rybakowski JK. Psychiatric manifestations in Wilson’s disease: possibilities and difficulties for treatment. Ther Adv Psychopharmacol. 2018;8(7):199–211.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Hadrian K, Przybyłkowski A. Toxic milk mice models of Wilson’s disease. Mol Biol Rep. 2021;48(2):1903–14.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Dong Y, Ni W, Chen WJ, Wan B, Zhao GX, Shi ZQ, et al. Spectrum and classification of ATP7B variants in a large cohort of Chinese patients with Wilson’s Disease guides Genetic diagnosis. Theranostics. 2016;6(5):638–49.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Behari M, Pardasani V. Genetics of wilsons disease. Parkinsonism Relat Disord. 2010;16(10):639–44.

    Article  PubMed  Google Scholar 

  30. Das S, Mohammed A, Mandal T, Maji S, Verma J, Ruturaj, Gupta A. Polarized trafficking and copper transport activity of ATP7B: a mutational approach to establish genotype-phenotype correlation in Wilson disease. Hum Mutat. 2022;43(10):1408–29.

    Article  CAS  PubMed  Google Scholar 

  31. Wu ZY, Wang N, Lin MT, Fang L, Murong SX, Yu L. Mutation analysis and the correlation between genotype and phenotype of Arg778Leu mutation in Chinese patients with Wilson disease. Arch Neurol. 2001;58(6):971–6.

    Article  CAS  PubMed  Google Scholar 

  32. Yang GM, Xu L, Wang RM, Tao X, Zheng ZW, Chang S, et al. Structures of the human Wilson disease copper transporter ATP7B. Cell Rep. 2023;42(5):112417.

    Article  CAS  PubMed  Google Scholar 

  33. Dmitriev OY, Bhattacharjee A, Nokhrin S, Uhlemann EM, Lutsenko S. Difference in stability of the N-domain underlies distinct intracellular properties of the E1064A and H1069Q mutants of copper-transporting ATPase ATP7B. J Biol Chem. 2011;286(18):16355–62.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Zhu M, Dong Y, Ni W, Wu ZY. Defective roles of ATP7B missense mutations in cellular copper tolerance and copper excretion. Mol Cell Neurosci. 2015;67:31–6.

    Article  CAS  PubMed  Google Scholar 

  35. Horoupian DS, Sternlieb I, Scheinberg IH. Neuropathological findings in penicillamine-treated patients with Wilson’s disease. Clin Neuropathol. 1988;7(2):62–7.

    CAS  PubMed  Google Scholar 

  36. Dusek P, Litwin T, Członkowska A. Neurologic impairment in Wilson disease. Ann Transl Med. 2019;7(Suppl 2):S64.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Pawaskar RS, Velhal GD. Hepatic encephalopathy in Wilson’s disease. Indian J Med Res. 2020;152(Suppl 1):S150–1.

    PubMed  PubMed Central  Google Scholar 

  38. Butterworth RF. The liver-brain axis in liver failure: neuroinflammation and encephalopathy. Nat Rev Gastroenterol Hepatol. 2013;10(9):522–8.

    Article  CAS  PubMed  Google Scholar 

  39. Telianidis J, Hung YH, Materia S, Fontaine SL. Role of the P-Type ATPases, ATP7A and ATP7B in brain copper homeostasis. Front Aging Neurosci. 2013;5:44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Washington-Hughes CL, Roy S, Seneviratne HK, Karuppagounder SS, Morel Y, Jones JW, et al. Atp7b-dependent choroid plexus dysfunction causes transient copper deficit and metabolic changes in the developing mouse brain. PLoS Genet. 2023;19(1):e1010558.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We express our gratitude to Dr. Kelei Cao from the Zhejiang University School of Medicine for helpful suggestions on the manuscript.

Funding

This work was supported by the Natural Science Foundation of Anhui Province (Grant No. 2208085MH226), Scientific Research Project of Higher Education Institutions in Anhui Province (Grant No. 2023AH050778), and Research Funds of Center for Xin’an Medicine and Modernization of Traditional Chinese Medicine of IHM (2023CXMMTCM002).

Author information

Author notes

  1. Jianjian Dong, Guanghai Xiang and Xiaoxue Xia contributed equally to this work.

Authors and Affiliations

  1. Institute of Neurology, Anhui University of Chinese Medicine, 357, Changjiang Rd. Middle, Hefei, Anhui, 230061, China

    Jianjian Dong, Xiaoxue Xia, Lewen Xu, Peihua Wen, Chenchen Xu, Yin Xu, Yongzhu Han, Yongsheng Han & Nan Cheng

  2. Center for Xin-An Medicine and Modernization of Traditional Chinese Medicine of IHM, Anhui University of Chinese Medicine, Hefei, 230012, China

    Jianjian Dong, Yongzhu Han, Yongsheng Han & Nan Cheng

  3. Key Laboratory of Immune Response and Immunotherapy, Institute of Health and Medicine, Hefei Comprehensive National Science Center, Hefei, 230601, China

    Guanghai Xiang

  4. School of Life Sciences, Anhui Medical University, Hefei, 230032, China

    Yushuang Su & Hong Zhou

  5. Institute of Zoology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, 1 Beichen West Rd, Beijing, 100101, China

    Yanze Song & Haoyi Wang

  6. High Magnetic Field Laboratory, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Hefei, 230031, China

    Haiyang Tong & Qingjun Zhu

  7. School of Basic Medical Science, Anhui Medical University, Hefei, 230032, China

    Hong Zhou

Authors
  1. Jianjian Dong
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Guanghai Xiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Xiaoxue Xia
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Lewen Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Peihua Wen
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Chenchen Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Yin Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Yushuang Su
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Yanze Song
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Haiyang Tong
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Qingjun Zhu
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Yongzhu Han
    View author publications

    You can also search for this author in PubMed Google Scholar

  13. Yongsheng Han
    View author publications

    You can also search for this author in PubMed Google Scholar

  14. Nan Cheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  15. Haoyi Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  16. Hong Zhou
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

JJD, HZ, NC, and YZH designed the study. GHX, YZS, and HYW constructed the mouse models. JJD, HYT, and QJZ prepared the murine samples for analysis. XXX and YX performed immunohistochemical imaging and helped with the Sholl analysis. JJD and YSS performed the behavioral experiments and microscopy. LWX, PHW, and CCX performed the qPCR and western blotting, respectively. JJD analyzed the data and plotted the figures. JJD, GHX and HZ wrote the manuscript. YSH conducted data organization and revised the manuscript. All authors have read and approved the final version of the manuscript.

Corresponding authors

Correspondence to Nan Cheng, Haoyi Wang or Hong Zhou.

Ethics declarations

Ethics approval and consent to participate

The study was approved by the Animal Ethics Committee of Anhui University of Chinese Medicine (AHUCM-mouse-2023130). Consent to participate was not possible because this was an animal study.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Dong, J., Xiang, G., Xia, X. et al. Aberrant copper metabolism and hepatic inflammation cause neurological manifestations in a mouse model of Wilson’s disease. J Neuroinflammation 21, 235 (2024). https://doi.org/10.1186/s12974-024-03178-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12974-024-03178-5

Keywords

Journal of Neuroinflammation

ISSN: 1742-2094