Journal of Neuroinflammation

Table 1 Sequence of specific primers used for quantitative real-time PCR

From: Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal rat brain following hypoxia: role of TLR4 in hypoxic microglia

Gene		Sequence
TLR4	Forward	ctacctggaatgggaggaca
TLR4	Reverse	cttagcagccatgtgttcca
HIF-1α	Forward	gcagcaggaattggaacatt
HIF-1α	Reverse	gcatgctaaatcggagggta
TNF-α	Forward	cgtcagccgatttgctatct
TNF-α	Reverse	cggactccgcaaagtctaag
IL-1β	Forward	gcccatcctctgtgactcat
IL-1β	Reverse	aggccacaggtattttgtcg
iNOS	Forward	gcttgtctctgggtcctctg
iNOS	Reverse	ctcactgggacagcacagaa
NF-κB	Forward	gcgtacacattctggggagt
NF-κB	Reverse	ccgaagcaggagctatcaac

TLR4, Toll-like receptor 4; HIF-1α, Hypoxia-inducible factor-1 alpha; iNOS, Inducible nitric oxide synthase; NF-κB, Nuclear factor kappa-light-chain-enhancer of activated B cells.

Back to article page

ISSN: 1742-2094

Contact us

Submission enquiries: journalsubmissions@springernature.com