Skip to main content

Table 1 List of primers

From: Regulatory role of TRIM21 in the type-I interferon pathway in Japanese encephalitis virus-infected human microglial cells

Gene name Primer sequence (5′-3′)
TRIM21 Fwd: 5′ AGAGAGACTTCACCTGTTCTGT 3′
Rev: 5′ TCAGTTCCCCTAATGCCACCT 3′
TRIM21 (ΔRING) Fwd: 5′ TACGAATTCCGGCAGCGCTTTCTGCTC 3′
Rev: 5′ GCCAAGCTTATAGTCAGTGGATCCTTG 3′
IFN-β1 Fwd: 5′ GCTCTCCTGTTGTGCTTCTCCAC 3′
Rev: 5′ CAATAGTCTCATTCCAGCCAGTGC 3′
β-Actin Fwd: 5′ GTCTGCCTTGGTAGTGGATAATG 3′
Rev: 5′ TCGAGGACGCCCTATCATGG 3′