Skip to main content

Table 1 List of primers and probes used in the present study

From: Cytokine responses during chronic denervation

Cytokine 5' primer 3' primer Probe
GAPDH TCAACTACATGGTCTACATGTTCCAG TCCCATTCTCAGCCTTGACTG TGACTCTACCCACGGCAAGTTCAACG
IFN-γ TCGAATCGCACCTGATCACTA GGGTTGTTCACCTCGAACTTG CATCCTTTTTTGCTTTACTGTTGCTGAGAAG
IL-1β GAAAGACGGCACACCCACC AAACCGCTTTTCCATCTTCTTCT TGCAGCTGGAGAGTGTGGATCCCAAAC
IL-10 CCCTCTGGATACAGCTGCG GCTCCACTGCCTTGCTTTTATT CGCTGTCATCGATTTCTCCCCTGTGA
TNF-α GACCCTCACACTCAGATCATCTTCT ACGCTGGCTCAGCCACTC TAGCCCACGTCGTAGCAAACCACCAA
  1. The probes were labeled with FAM in the 5' end and TAMRA in the 3' end.