Skip to main content

Table 2 Real-time PCR primers

From: Resveratrol differentially modulates inflammatory responses of microglia and astrocytes

Gene Real-time PCR primers
TNF-α sense: 5'-AGCCGATGGGTTGTACCTTGTCTA
  antisense: 5'- TGAGATAGCAAATCGGCTGACGGT
IL-1β sense: 5'-ACAGAATATCAACCAACAAGTGATATTCTC
  antisense: 5'-GATTCTTTCCTTTGAGGCCCA
IL-6 sense: 5'-ATCCAGTTGCCTTCTTGGGACTGA
  antisense: 5'-TAAGCCTCCGACTTGTGAAGTGGT
MCP-1 sense: 5'-CCCACTCACCTGCTGCTACT
  antisense: 5'-TCTGGACCCATTCCTTCTTG
iNOS sense: 5'-GGCAGCCTGTGAGACCTTTG
  antisense: 5'-GAAGCGTTTCGGGATCTGAA
β-actin sense: 5'-CAACGAGCGGTTCCGAT
  antisense; 5'-GCCACAGGATTCCATACCCA