Skip to main content

Table 1 Primer pairs and Roche library probes for real-time qRT-PCR validation

From: Curcumin is a potent modulator of microglial gene expression and migration

Gene F-Primer (5'-3') R-Primer (5'-3') Roche Library Probe
Atp5b ggcacaatgcaggaaagg tcagcaggcacatagatagcc 77
C3 accttacctcggcaagtttct ttgtagagctgctggtcagg 76
Ccl2 catccacgtgttggctca gatcatcttgctggtgaatgagt 62
Dll1 ttcaactgtgagaagaagatggat gccgaggtccacacactt 103
Egr2 ctacccggtggaagacctc aatgttgatcatgccatctcc 60
Il4 catcggcattttgaacgag cgagctcactctctgtggtg 2
Il6 gatggatgctaccaaactggat ccaggtagctatggtactccaga 6
Nos2 ctttgccacggacgagac tcattgtactctgagggctga 13
Ntng1 aggggcaagagaccaagg agggatggtgtctatcgtcct 103
Pecam1 cggtgttcagcgagatcc cgacaggatggaaatcacaa 45
Perp1 tcatatgccggctcacct atccactggcgtctggagt 110
Pparα ccgagggctctgtcatca gggcagctgactgaggaa 11
Ptgs2 gatgctcttccgagctgtg ggattggaacagcaaggattt 45
Stat1 aaatgtgaaggatcaagtcatgtg catcttgtaattcttctagggtcttga 15
Tlr2 accgaaacctcagacaaagc cagcgtttgctgaagagga 49