Skip to main content

Advertisement

Table 1 Sequences for primers and probes employed in this study

From: Cannabidiol reduces lipopolysaccharide-induced vascular changes and inflammation in the mouse brain: an intravital microscopy study

GENES PRIMER/PROBE SEQUENCES FOR PRIMERS AND PROBES
18S sense AAATCAGTTATGGTTCCTTTGGTC
  antisense GCTCTAGAATTACCACAGTTATCCAA
  Probe #55 Use universal ProbeLibrary, Roche Applied Science
iNOS sense GCTCCTCCCAGGACCACA
  antisense GCTGGAAGCCACTGACACTT
  Probe TaqMan 6FAM-CACCTACCGCACCCGAGATGG--BBQ
COX-2 sense TGACCCACTTCAAGGGAGTCT
  antisense CTGTCAATCAAATATGATCTGGATGTC
  Probe TaqMan 6FAM-AACAACATCCCCTTCCTGCGAAGTT--BBQ
TNF-α sense GCCTATGTCTCAGCCTCTTCTCATT
  antisense CCACTTGGTGGTTTGCTACGA
  Probe TaqMan 6FAM-CCATAGAACTGATGAGAGGGAGGCCATTT-BBQ