Skip to main content

Table 1 List of primers

From: HIV-1 Tat C-mediated regulation of tumor necrosis factor receptor-associated factor-3 by microRNA 32 in human microglia

Gene Direction Primer sequence 5′→3′
Tat –C Forward GGAATTCCATATGATGGAGCCAGTAGATCC
Reverse CCGCTCGAGATCGAATGGATCTGTCTTTG.
IFNB1 Forward GCTCTCCTGTTGTGCTTCTCCAC
Reverse CAATAGTCTCATTCCAGCCAGTGC
IRF7 Forward GCTGGACGTGACCATCATGTA
Reverse GGGCCGTATAGGAACGTGC
Beta-actin Forward TCATGAAGTGTGACGTGGAC
Reverse CAGGAGGAGCAATGATCTTGAT
TRAF3 Forward GCGTGTCAAGAGAGCATCGTT
Reverse GCAGATGTCCCAGCATTAACT-3
IRF3 Forward GTGGCCTGGGTGAACAAGAG
Reverse TGGAAGATTCCGAAATCCTCCT
MUT TRAF3 3′ UTR Forward CAACAAGATAAATGCTGTCAGAGAAGG3′
  Reverse CCTTCTCTGACAGCATTTATCTTGTTG 3′