Skip to main content

Table 1 Primers used for amplification

From: α7 nicotinic acetylcholine receptor-mediated neuroprotection against dopaminergic neuron loss in an MPTP mouse model via inhibition of astrocyte activation

Name Genbank accession number Direction Sequence, 5′→3′ Size of product bp
GADPH NM_008084.2 Forward TGTGTCCGTCGTGGATCTGA 150
Reverse TTGCTGTTGAAGTCGCAGGAG
α7 subunit NM 007390.3 Forward AACCATGCGCCGTAGGACA 172
Reverse CTCAGCCACAAGCAGCATGAA
  1. GADPH, glyceraldehyde-3-phosphate dehydrogenase.