Skip to main content

Table 1 PCR primer sequences

From: Liver X receptor-dependent inhibition of microglial nitric oxide synthase 2

Primer ID Forward Reverse Position relative to TSS
Nos2_ChIP GGAGTGTCCATCATGAATGAG CAACTCCCTGTAAAGTTGTGACC −159 to −15
Nos2_ChIP2 CCAGAACAAAATCCCTCAGC CTCATGCAAGGCCATCTCTT −355 to −198
Nos2_ChIP3 AGCACAGCCCATCCACTATT CGGAGCTCTCTGGCTTTCT −551 to −359
Nos2_ChIP4 AAAGGCTTATGCCACCACAC TTTTCTCAGTGGCATTCTCTCTC −748 to −572
Nos2_ChIP5 AATTCCATGCCATGTGTGAA TGATCCCTGAGTTTGGGCTA −936 to −779
Nos2_ChIP6 TTGAGGCCACACACTTTTTG TGACAGTGTTAGGGGAAAAGG −1124 to −959
Nos2_ChIP7 TCACCACACCCAGCATTTTA GGGAGATGGCTCAGTTGGTA −1387 to −1188
Nos2_ChIP8 GGGTGTTGCCTGGATAAAGA GTTCCAGGCTGGTGAGAGAT −1654 to −1472
Nos2_ChIP9 AAGGGTTCCATTGTGACAAAC CCCAATACTTGGGAAAGACG −1855 to −1663
Nos2_ChIP10 CAGCCAAGCACTCCAATGTA TTACAGCTACGCCTGCAACA −2002 to −1880
Nos2_ChIP11 AAACTTCTCAGCCACCTTGG TTCCCAAGCAGGAAGACACT 30 to 189
Nos2_ChIP12 AAACCAGGCTTTCCCTTCTC TTGCAGAGAAGAAATCTGACCA 198 to 336
Nos2 a GCTTCACTCAGCACAGCCCATCCAC GCTAAACCACATACCCTGGCTTGCAG −560 to −308
Nos2 b GCCAGCCTCCCTCCCTAGTGAGTCC GACCCTGGCAGCAGCCATCAGGTAT −299 to −34
Nos2 c CCTGCTTGGGAAAGCCCAGAAAACC TGGGGCAGAGGGCACATCTCATAAA 178 to 462
TNF a TCTAAATGGGACATCCATGGGGGAGA TCCGTGAATTCCCAGGGCTGAGTTC −673 to −424
TNF b ACACCCTCCTGATTGGCCCCAGATT CTTGCTGTCCTCGCTGAGGGAGCTT −278 to 18
TNF c CCCCTCCACACTCTCCTCCACCTTG GGCAGAAGAGGCACTCCCCCAAAAG 191 to 464
GAPDH AGTGCCCACTCCCCTTCCCAGTTTC GAGGCCCAGCTACTCGCGGCTTTA −178 to 98
Rhodopsin CAGCCTGAGGCCACCAGACTGACAT CACAGCGCAACTCCAGGCACTGAC −268 to −6