Skip to main content

Table 2 Primer sequences for One-Step RT-PCR analysis

From: Anti-inflammatory activity of Wnt signaling in enteric nervous system: in vitro preliminary evidences in rat primary cultures

Gene Abbreviations Primer sequences Accession
Glial cell-derived neurotrophic factor GDNF F: CCAGAGAATTCCAGAGGGAAAG NM_019139.1
R: CTTCACAGGAACCGCTACAA
Epidermal growth factor EGF F: GGGCTATCCCATCGGTAATAAG NM_012842.1
R: CAGCCTCCATTCCTGTGTAA
Basic fibroblast growth factor BFGF F: AGAGGAGTTGTGTCCATCAAG NM_019305.2
R: CTCCAGGCGTTCAAAGAAGA
Nerve growth factor NGF F: CAGTGTGTGGGTTGGAGATAA NM_001277055.1
R: GCATCCACTCTCTACAGGATTC
Leukemia inhibitory factor LIF F: TGACGGATTTCCCACCTTTC NM_022196.2
R: CGTCTGTAGTCGCATTGAGTT
Hypoxanthine-guanine phosphoribosyltransferase HPRT F: GCTGACCTGCTGGATTACAT NM_012583.2
R: CCCGTTGACTGGTCATTACA
  1. F forward, R reverse.