Skip to main content

Advertisement

Table 1 Primer sequences for real-time qPCR analysis of piglet gene expression

From: Early inflammatory mediator gene expression in two models of traumatic brain injury: ex vivo cortical slice in mice and in vivo cortical impact in piglets

mRNA Swine primer sequence (5′ - 3′) Amplicon a (bp) Accession # b
IL-1β Fc AGGCACAAAGGCCATTCAGT 102 NM_001005149.1
IL-1β Rc ACTTCCTTGGCAGGTTCAGG   
TNF-α F CATCTACCTGGGAGGGGTCT 109 NM_214022.1
TNF-α R ACCTGCCCAGATTCAGCAAA   
CCL2 F CACCAGCAGCAAGTGTCCTA 86 NM_214214.1
CCL2 R CCCACTTCTGCTTGGGTTCT   
CCL3 F TATTTTGAGACCAGCAGCCAGT 127 NM_001009579.1
CCL3 R CATTCAGCTCCAGGTCAGAGAT   
CCL4 F TTCACATACACCGTGCGGAA 148 NM_213779.1
CCL4 R ACTCCTGGACCCAGTCATCA   
PTGS2 F CCAGCACTTCACCCATCAGT 132 NM_214321.1
PTGS2 R AGGCGCAGTTTATGCTGTCT   
β-actin F CAAGCAGGAGTACGACGAGT 145 XM_003357928.2
β-actin R GGCTGGCATGAGGTGTGTA   
GAPDH F AAGGTCGGAGTGAACGGATT 149 NM_001206359.1
GAPDH R CCGTGGGTGGAATCATACTGG   
  1. aPredicted number of base pairs (bp) in PCR product; bNCBI reference sequence; cF, forward primer; R, reverse primer. CCL2, chemokine ligand 2; CCL3, chemokine ligand 3; CCL4, chemokine ligand 4; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-1β, interleukin-1β; PTGS2, prostaglandin-endoperoxide synthase 2; TNF-α, tumor necrosis factor-α.