Skip to main content

Advertisement

Table 1 Specific primers for cytokine, type I IFNs, PRRs, IRFs, and ISGs used in real-time qRT-PCR

From: Amelioration of Japanese encephalitis by blockage of 4-1BB signaling is coupled to divergent enhancement of type I/II IFN responses and Ly-6Chi monocyte differentiation

Gene namea Primer sequence (5′-3′)b Position cDNA Gene Bank ID
TNF-α FP: CGT CGT AGC AAA CCA CCA AG 438-457 NM_013693
RP: TTG AAG AGA ACC TGG GAG TAG ACA 564-587
IFN-α FP: TGTCTGATGCAGCAGGTGG 367-385 NM_008334.3
RP: AAGACAGGGCTCTCCAGAC 514-532
IFN-β FP: TCCAAGAAAGGACGAACATTCG 106-121 NM_010510
RP: TGAGGACATCTCCCACGTCAA 399-419
IRF3 FP: GAT GGA GAG GTC CAC AAG GA 1170-1189 NM_016849
RP: GAG TGT AGC GTG GGG AGT GT 1259-1278
IRF7 FP: CCT CTT GCT TCA GGT TCT GC 980-999 NM_016850.3
RP: GCT GCA TAG GGT TCC TCG TA 1080-1099
RIG-I FP: CCA CCT ACA TCC TCA GCT ACA TGA 194-217 NM_172689
RP: TGG GCC CTT GTT GTT CTT CT 260-279
MDA5 FP: GGC ACC ATG GGA AGT GAT T 1178-1196 NM_027835
RP: ATT TGG TAA GGC CTG AGC TG 1247-1266
ISG49 FP: GCC GTT ACA GGG AAA TAC TGG 919-939 NM_010501.2
RP: CCT CAA CAT CGG GGC TCT 1126-1143
ISG54 FP: GGG AAA GCA GAG GAA ATC AA 1918-1937 NM_008332.3
RP: TGA AAG TTG CCA TAC AGA AG 2005-2024
ISG56 FP: CAG AAG CAC ACA TTG AAG AA 774-793 NM_008331.3
RP: TGT AAG TAG CCA GAG GAA GG 911-930
β-Actin FP: TGG AAT CCC TGT GGG ACC ATG AAA C 885-909 NM_007393.3
RP: TAA AAC GCA GCT CAG TAA CAG TCC G 1209-1233
  1. a IL interleukin, TNF-α tumor necrosis factor-α, IFN interferon
  2. b FP forward primer, RP reverse primer