Skip to main content

Table 1 qRT-PCR primers used in this study

From: Monomethyl fumarate promotes Nrf2-dependent neuroprotection in retinal ischemia-reperfusion

Gene Sense primer (5′-3′) Antisense primer (5′-3′)
NQO1 CAGCTCACCGAGAGCCTAGT ACCACCTCCCATCCTTTCTT
HO-1 ATGACACCAAGGACCAGAGC GTGTAAGGACCCATCGGAGA
Prdx1 AATGCAAAAATTGGGTATCCTGC CGTGGGACACACAAAAGTAAAGT
Txnrd1 AACTTTCAGAAGGGCCAGGT GTAGACAGGGGCGAAGACTG
Gstm1 AGTGGGTGGGAAAGGGTCATTACA TAGCCAAGGC TTCTGCTGGTACTT
IL-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG
ICAM-1 ACACTATGTGGACTGGCAGTGGTT TGAGGCTCGATTGTTCAGCTGCTA
CCL12 ATTTCCACACTTCTATGCCTCCT ATCCAGTATGGTCCTGAAGATCA
CCL2 CATCCACGTGTTGGCTCA TCTGGACCCATTCCTTCTTG
CCL7 GCTGCTTTCAGCATCCAAGTG CCAGGGACACCGACTACTG
Cyclophilin A GAGCTGTTTGCAGACAAAGTT CCCTGGCACATGAATCCTGG