Skip to main content

Table 1 The primers for PCR amplification

From: Potential role of microRNA-7 in the anti-neuroinflammation effects of nicorandil in astrocytes induced by oxygen-glucose deprivation

Gene name Forward (5′ to 3′) Reversed (5′ to 3′)
Herpud2 (mouse) GGCCCAGTGCTGAATGAAGA CAGCATGGCTCCCATTACCA
GAPDH (mouse) CATGGCCTTCCGTGTTCCTA CCTGCTTCACCACCTTCTTGAT
miR-7 RT (mouse) AGCATTCGTCTCGACACAGCAACAAAATC
MiR-7 (mouse) TGACTCTGCTGGAAGACTAGTGAT TAGAGCATTCGTCTCGACACAG
U6 RT (mouse) AACGCTTCACGAATTTGCGT
U6 (mouse) CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
WT vector for Herpud2 3′UTR (mouse) cacaactcgagTAAGCTTCTCATGCATATGA aaggatccGGGCAAGATGCTACTAGCACA
Mut vector for Herpud2 3′UTR (mouse) TACTGCAGAAGGAGCTTTATTCATTTCAATTATGTGTA AGCTCCTTCTGCAGTACTGTTAGCAATGCTATGTTGTTAG