Skip to main content

Advertisement

Table 1 Specific primers for cytokines, chemokines, type I IFNs, and ISGs used in real-time qRT-PCR

From: Blockage of indoleamine 2,3-dioxygenase regulates Japanese encephalitis via enhancement of type I/II IFN innate and adaptive T-cell responses

Gene name Primer sequence (5′-3′) Position cDNA GeneBank ID
IL-6 FP: TGG GAA ATC GTG GAA ATG AG RP: CTC TGA AGG ACT CTG GCT TTG 209–228 442–462 NM_031168
TNF-α FP: CGT CGT AGC AAA CCA CCA AG RP: TTG AAG AGA ACC TGG GAG TAG ACA 438–457 564–587 NM_013693
IFN-α FP: TGTCTGATGCAGCAGGTGG RP: AAGACAGGGCTCTCCAGAC 367–385 514–532 NM_008334.3
IFN-β FP: TCCAAGAAAGGACGAACATTCG RP: TGAGGACATCTCCCACGTCAA 106–121 399–419 NM_010510
CCL2 FP: AAA AAC CTG GAT CGG AAC CAA RP: CGG GTC AAC TTC ACA TTC AAA G 347–367 426–447 NM_011333
CCL3 FP: CCA AGT CTT CTC AGC GCC AT RP: GAA TCT TCC GGC TGT AGG AGA AG 158–177 206–228 NM_011337.2
CCL4 FP: TTC TGT GCT CCA GGG TTC TC RP: GAG GAG GCC TCT CCT GAA GT 128–147 388–407 NM_013652.2
CCL5 FP: CCC TCA CCA TCA TCC TCA CT RP: CTT CTT CTC TGG GTT GGC AC 77–96 275–294 NM_013653.3
IRF3 FP: GAT GGA GAG GTC CAC AAG GA RP: GAG TGT AGC GTG GGG AGT GT 1170–1189 1259–1278 NM_016849
IRF5 FP: GGA AGA AAT GAA GCC AGC AG RP: ACC CTG GGG TAA TTG GAC TC 1931–1950 2001–2020 NM_001252382.1
IRF7 FP: CCT CTT GCT TCA GGT TCT GC RP: GCT GCA TAG GGT TCC TCG TA 980–999 1080–1099 NM_016850.3
RIG-I FP: CCA CCT ACA TCC TCA GCT ACA TGA RP: TGG GCC CTT GTT GTT CTT CT 194–217 260–279 NM_172689
MDA5 FP: GGC ACC ATG GGA AGT GAT T RP: ATT TGG TAA GGC CTG AGC TG 1178–1196 1247–1266 NM_027835
PKR FP: AAC TTC TTC ACA CGT GCT TC RP: CAT TCA GCC AAG GTC TTC AG 1517–1536 1678–1697 NM_011163
STAT1 FP: AAG CGA ACT GGA TAC ATC A RP: CCG GGA CAT CTC ATC AAA C 2093–2111 2194–2212 U06924.1
2′5′-Oas1 FP: CCA TCC TCA AGT GGA CAA GAA CTG RP: TTG GGC TTT GGG CAC CTT C 1235–1258 1359–1377 AF466822.1
Oasl-1 FP: CCA GGA AGA AGC CAA GCA CCA TC RP: AGG TTA CTG AGC CCA AGG TCC ATC 377–399 449–472 NM_145209.3
Mx1 FP: CAG CAC CTG ATG GCC TAT CA RP: ACG TCT GGA GCA TGA AGA ACT G 2276–2295 2363–2342 NM_010846.1
Mx2 FP: AGG CTC ACA ACC GCA TCT RP: GCT CAG CAA ACA TTT TCA GG 1858–1875 1910–1929 NM_013606.1
ISG49 FP: GCC GTT ACA GGG AAA TAC TGG RP: CCT CAA CAT CGG GGC TCT 919–939 1126–1143 NM_010501.2
ISG54 FP: GGG AAA GCA GAG GAA ATC AA RP: TGA AAG TTG CCA TAC AGA AG 1918–1937 2005–2024 NM_008332.3
ISG56 FP: CAG AAG CAC ACA TTG AAG AA RP: TGT AAG TAG CCA GAG GAA GG 774–793 911–930 NM_008331.3
β-actin FP: TGG AAT CCC TGT GGG ACC ATG AAA C RP: TAA AAC GCA GCT CAG TAA CAG TCC G 885–909 1209–1233 NM_007393.3
  1. IL interleukin, TNF-α tumor necrosis factor-α, IFN interferon, FP forward primer, RP reverse primer