Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Specific primers for cytokines, chemokines, type I IFNs, and ISGs used in real-time qRT-PCR

From: Blockage of indoleamine 2,3-dioxygenase regulates Japanese encephalitis via enhancement of type I/II IFN innate and adaptive T-cell responses

Gene name Primer sequence (5′-3′) Position cDNA GeneBank ID
IL-6 FP: TGG GAA ATC GTG GAA ATG AG
RP: CTC TGA AGG ACT CTG GCT TTG
209–228
442–462
NM_031168
TNF-α FP: CGT CGT AGC AAA CCA CCA AG
RP: TTG AAG AGA ACC TGG GAG TAG ACA
438–457
564–587
NM_013693
IFN-α FP: TGTCTGATGCAGCAGGTGG
RP: AAGACAGGGCTCTCCAGAC
367–385
514–532
NM_008334.3
IFN-β FP: TCCAAGAAAGGACGAACATTCG
RP: TGAGGACATCTCCCACGTCAA
106–121
399–419
NM_010510
CCL2 FP: AAA AAC CTG GAT CGG AAC CAA
RP: CGG GTC AAC TTC ACA TTC AAA G
347–367
426–447
NM_011333
CCL3 FP: CCA AGT CTT CTC AGC GCC AT
RP: GAA TCT TCC GGC TGT AGG AGA AG
158–177
206–228
NM_011337.2
CCL4 FP: TTC TGT GCT CCA GGG TTC TC
RP: GAG GAG GCC TCT CCT GAA GT
128–147
388–407
NM_013652.2
CCL5 FP: CCC TCA CCA TCA TCC TCA CT
RP: CTT CTT CTC TGG GTT GGC AC
77–96
275–294
NM_013653.3
IRF3 FP: GAT GGA GAG GTC CAC AAG GA
RP: GAG TGT AGC GTG GGG AGT GT
1170–1189
1259–1278
NM_016849
IRF5 FP: GGA AGA AAT GAA GCC AGC AG
RP: ACC CTG GGG TAA TTG GAC TC
1931–1950
2001–2020
NM_001252382.1
IRF7 FP: CCT CTT GCT TCA GGT TCT GC
RP: GCT GCA TAG GGT TCC TCG TA
980–999
1080–1099
NM_016850.3
RIG-I FP: CCA CCT ACA TCC TCA GCT ACA TGA
RP: TGG GCC CTT GTT GTT CTT CT
194–217
260–279
NM_172689
MDA5 FP: GGC ACC ATG GGA AGT GAT T
RP: ATT TGG TAA GGC CTG AGC TG
1178–1196
1247–1266
NM_027835
PKR FP: AAC TTC TTC ACA CGT GCT TC
RP: CAT TCA GCC AAG GTC TTC AG
1517–1536
1678–1697
NM_011163
STAT1 FP: AAG CGA ACT GGA TAC ATC A
RP: CCG GGA CAT CTC ATC AAA C
2093–2111
2194–2212
U06924.1
2′5′-Oas1 FP: CCA TCC TCA AGT GGA CAA GAA CTG
RP: TTG GGC TTT GGG CAC CTT C
1235–1258
1359–1377
AF466822.1
Oasl-1 FP: CCA GGA AGA AGC CAA GCA CCA TC
RP: AGG TTA CTG AGC CCA AGG TCC ATC
377–399
449–472
NM_145209.3
Mx1 FP: CAG CAC CTG ATG GCC TAT CA
RP: ACG TCT GGA GCA TGA AGA ACT G
2276–2295
2363–2342
NM_010846.1
Mx2 FP: AGG CTC ACA ACC GCA TCT
RP: GCT CAG CAA ACA TTT TCA GG
1858–1875
1910–1929
NM_013606.1
ISG49 FP: GCC GTT ACA GGG AAA TAC TGG
RP: CCT CAA CAT CGG GGC TCT
919–939
1126–1143
NM_010501.2
ISG54 FP: GGG AAA GCA GAG GAA ATC AA
RP: TGA AAG TTG CCA TAC AGA AG
1918–1937
2005–2024
NM_008332.3
ISG56 FP: CAG AAG CAC ACA TTG AAG AA
RP: TGT AAG TAG CCA GAG GAA GG
774–793
911–930
NM_008331.3
β-actin FP: TGG AAT CCC TGT GGG ACC ATG AAA C
RP: TAA AAC GCA GCT CAG TAA CAG TCC G
885–909
1209–1233
NM_007393.3
  1. IL interleukin, TNF-α tumor necrosis factor-α, IFN interferon, FP forward primer, RP reverse primer