Skip to main content

Advertisement

Table 1 Quantitative PCR primer sequences

From: Retinal glial responses to optic nerve crush are attenuated in Bax-deficient mice and modulated by purinergic signaling pathways

Gene Name Primer sequence 5′ ➔ 3′ Size (bp)
Aif1 F: AGAGAGGTGTCCAGTGGC
R: CCCCACCGTGTGACCTCC
200
Cd68 F: GGACTACATGGCGGTGGAAT
R: GCAAGAGAAACATGGCCCGA
229
Gfap F: CAAACTGGCTGATGTCTACC
R: AGAACTGGATCTCCTCATCC
269
Nes F: GGGCCAGCACTCTTAGCTTTGATA
R: TGAGCCTTCAGGGTGATCCAG
106
Nrn1 F: TTCACTGATCCTCGCGGTGC
R: TACTTTCGCCCCTTCCTGGC
238
Panx1 F: GCTGCACAAGTTCTTCCCCT
R: ATCTCGAGCACTCTTGGCAG
175
Sncg F: GACCAAGCAGGGAGTAACGG
R: TCCAAGTCCTCCTTGCGCAC
240
S16 F: CACTGCAAACGGGGAAATGG
R: TGAGATGGACTGTCGGATGG
198