Skip to main content

Table 1 Primers used for reverse transcription polymerase chain reaction (RT-PCR)

From: Oncostatin M promotes excitotoxicity by inhibiting glutamate uptake in astrocytes: implications in HIV-associated neurotoxicity

Gene Forward primer (5′-3′) Backward primer (5′-3′)
GAPDH CATCCTGCACCACCAACTGCTTAG GCCTGCTTCACCACCTTCTTGATG
OSMR-β ATTCTGGACACGAAGAGGTCAAG TTCCACTGCAAATCACAGCG
gp130 TGGAAGGCACTGCCTCTTTC CTAGAGACGCGACATAGCGGT
GLAST CCTTCGTTCTGCTCACGGTC TTCACCTCCCGGTAGCTCAT
GLT-1 GTGCAAGCCTGTTTCCAGC GCCTTGGTGGTATTGGCCT