Skip to main content

Table 1 List of primers used in qRT-PCR studies

From: Transcriptome sequencing reveals that LPS-triggered transcriptional responses in established microglia BV2 cell lines are poorly representative of primary microglia

Gene designation Forward (5′ → 3′) Reverse (5′ → 3′)
CCL4 TTCCTGCTGTTTCTCTTACACCT CTGTCTGCCTCTTTTGGTCAG
CCL5 TTTGCCTACCTCTCCCTCG CGACTGCAAGATTGGAGCACT
CCL8 CTGGGCCAGATAAGGCTCC CATGGGGCACTGGATATTGTT
CXCL1 ACTGCACCCAAACCGAAGTC TGGGGACACCTTTTAGCATCTT
IFNB1 AGCTCCAAGAAAGGACGAACA GCCCTGTAGGTGAGGTTGAT
IFIT1 GCCTATCGCCAAGATTTAGATGA TTCTGGATTTAACCGGACAGC
IFIT2 GGAGAGCAATCTGCGACAG GCTGCCTCATTTAGACCTCTG
IFIT3 CCTACATAAAGCACCTAGATGGC ATGTGATAGTAGATCCAGGCGT
IRF1 ATG CCA ATC ACT CGA ATG CG TTG TAT CGG CCT GTG TGA ATG
IRF2 AATTCCAATACGATACCAGGGCT GAGCGGAGCATCCTTTTCCA
STAT1 TCACAGTGGTTCGAGCTTCAG CGAGACATCATAGGCAGCGTG
STAT2 GTTACACCAGGTCTACTCACAGA TGGTCTTCAATCCAGGTAGCC
KDM4A GAC CAC ACT CTG CCC ACA C TCC TGG GGT ATT TCC AGA CA
SETDB2 TGGGTCTGCCACAAATGGAG TCCAGTGTTTGCGTGTTACTC
GAPDH TGCGACTTCAACAGCAACTC CTTGCTCAGTGTCCTTGCTG