Skip to main content

Table 1 Quantitative real-time RT-PCR primer sequences

From: Lymphocytes influence intracranial aneurysm formation and rupture: role of extracellular matrix remodeling and phenotypic modulation of vascular smooth muscle cells

Gene Forward Reverse
Beta actin GATCATTGCTCCTCCTGAG ATCGTACTCCTGCTTGCT
Tissue necrosis factor TCGTAGCAAACCACCAAG AGCCTTGTCCCTTGAAGA
Interferon-γ GTATTGCCAAGTTTGAGGTC AATCAGCAGCGACTCCTT
Interleukin-6 ATTCATATCTTCAACCAAGAGG TCCTTAGCCACTCCTTCT
Matrix metalloproteinase 2 GGAGACAAGTTCTGGAGATA GGTTATCAGGGATGGCATT
Matrix metalloproteinase 9 GACATCTTCCAGTACCAAG CCACCTTGTTCACCTCAT
Smooth muscle myosin heavy chain CAGCTTGTCAGGAAGGAATA TGACAGCACCTTCTACCT
Smooth muscle actin CTTTCATTGGGATGGAGTCA GGCTGTGATCTCCTTCTG
Transgelin (SM22) TGTTCCAGACTGTTGACCT AGTTGGCTGTCTGTGAAGT