Skip to main content

Table 1 Primers used in this study

From: EGFR transactivation contributes to neuroinflammation in Streptococcus suis meningitis

Gene Forward (5′–3′) Reverse (5′–3′) Species
IL-6 GGACTGATGCTGGTGACAAC GGAGTGGTATCCTCTGTGAAGT Murine
IL-1α CTGAAGAAGAGACGGCTGAGTT CTGGTAGGTGTAAGGTGCTGAT Murine
MCP-1 ACTCACCTGCTGCTACTCAT TGTCTGGACCCATTCCTTCTT Murine
MIP-2 TGACTTCAAGAACATCCAGAG CCTTGCCTTTGTTCAGTATCT Murine
GRO- α TGGCTGGGATTCACCTCAA GTGGCTATGACTTCGGTTTGG Murine
β-actin GTCCCTCCTCTGATACCTTCCTC CTGGCAGTGTCATTCACATCTTTCT Murine
EGFR TACAGACCCAAGAGCAGCA AGCCGTACATAGATCCAGAA Human
ErbB2 GTCCCTCCTCTGATACCTTCCTC CTGGCAGTGTCATTCACATCTTTCT Human
ErbB3 TACAGACCCAAGAGCAGCA AGCCGTACATAGATCCAGAA Human
ErbB4 GTCCCTCCTCTGATACCTTCCTC CTGGCAGTGTCATTCACATCTTTCT Human
MIP-2 AGTGTGAAGGTGAAGTCC CTTTCTGCCCATTCTTGAG Human
GRO-α TGCTGCTCCTGCTCCTGGTA TGTGGCTATGACTTCGGTTTGG Human
IL-6 CCTTCGGTCCAGTTGCCTTCT GAGGTGAGTGGCTGTCTGTGT Human
MCP-1 ATAGCAGCCACCTTCATT GCTTCTTTGGGACACTTG Human
TNF-α AATGGCGTGGAGCTGAGA TGGCAGAGAGGAGGTTGAC Human
IL-8 GACATACTCCAAACCTTTCC ATTCTCAGCCCTCTTCAAA Human
GAPDH TGCCTCCTGCACCACCAACT CGCCTGCTTCACCACCTTC Human