Skip to main content

Table 1 List of primer sequences for mouse PCR

From: Differential expression of E-type prostanoid receptors 2 and 4 in microglia stimulated with lipopolysaccharide

  Primer sequence 5′→3′ Accession no. Amplicon length (bp) Region
SYBR green
 TNF-α (Tnfa) F: GGGGCCACCACGCTCTTCTGTC NM_013693 155 Exon 1
R: TGGGCTACGGGCTTGTCACTCG Exon 3
 Glucose-6P-dehydrogenase (G6pd) F: CACAGTGGACGACATCCGAAA NM_008062.2 103 Exon 4
R: AGCTACATAGGAATTACGGGCAA Exon 5
 iNOS (Nos2) F: CAGCTGGGCTGTACAAACCTT NM_010927 95 Exon 17
R: CATTGGAAGTGAAGCGTTTCG Exon 18
 VEGFA (Vegfa) F: ATCTTCAAGCCGTCCTGTGTGC NM_001025257.3 223 Exon 3
R: TTGGCTTGTCACATTTTTCTGG Exon 5/6
 rpl14 F: GGCTTTAGTGGATGGACCCT NM_025974 143 Exon 3
R: ATTGATATCCGCCTTCTCCC Exon 4
  ID Assay Accession no. Amplicon length (bp) Exon boundary
Taqman probes
 EP1 (Ptger1) Mm00443098_g1 NM_013641.2 85 Exon 2–3
 EP2 (Ptger2) Mm00436051_m1 NM_008964.4 73 Exon 1–2
 EP3 (Ptger3) Mm01316856_m1 NM_011196.2 79 Exon 1–2
 EP4 (Ptger4) Mm00436053_m1 NM_001136079.2 70 Exon 2–3
NM_008965.2
 NOX2 (Cybb) Mm01287743_m1 NM_007807.5 63 Exon 12–13
 gapdh Mm99999915_g1 NM_001289726.1 107 Exon 2–3
NM_008084.3
 hprt1 Mm00446968_m1 NM_013556.2 65 Exon 6–7