Skip to main content

Table 1 The primers used for qPCR analysis

From: Microglia activation is essential for BMP7-mediated retinal reactive gliosis

Gene Primer Sequence Product length
Gm-Csf Forward AGTCGTCTCTAACGAGTTCTCC 178
Reverse AACTTGTGTTTCACAGTCCGTT
Csf1 Forward ACCAAGAACTGCAACAACAGC 91
Reverse GGGTGGCTTTAGGGTACAGG
Inf-α Forward CAAGCCATCCCTGTCCTGAG 131
Reverse TCATTGAGCTGCTGGTGGAG
Inf-γ Forward CAACAGCAAGGCGAAAAAGGA 90
Reverse AGCTCATTGAATGCTTGGCG
Il-1β Forward TGTCTGAAGCAGCTATGGCAA 141
Reverse GACAGCCCAGGTCAAAGGTT
Il6 Forward ACTTCACAAGTCGGAGGCTT 111
Reverse TGCAAGTGCATCATCGTTGT
VEGF Forward ACTGGACCCTGGCTTTACTG 74
Reverse CTCTCCTTCTGTCGTGGGTG
Tnf-α Forward TAGCCCACGTCGTAGCAAAC 136
Reverse ACAAGGTACAACCCATCGGC
Ccl5 Forward TGCCCACGTCAAGGAGTATTT 111
Reverse ACCCACTTCTTCTCTGGGTTG
Thbs1 Forward GCCACAGTTCCTGATGGTGA 149
Reverse TTGAGGCTGTCACAGGAACG
Thbs2 Forward GGGAGGACTCAGACCTGGAT 105
Reverse CGGAATTTGGCAGTTTGGGG
Cd45 Forward TGACCATGGGTTTGTGGCTC 134
Reverse TTGAGGCAGAAGAAGGGCAT
Cd68 Forward AAGGGGGCTCTTGGGAACTA 139
Reverse AAGCCCTCTTTAAGCCCCAC
Iba1 Forward ACGAACCCTCTGATGTGGTC 118
Reverse TGAGGAGGACTGGCTGACTT
Irf8 Forward CGGATATGCCGCCTATGACA 73
Reverse CTTGCCCCCGTAGTAGAAGC
Sdha Forward GGACAGGCCACTCACTCTTAC 130
Reverse CACAGTGCAATGACACCACG
Srp14 Forward CCTCGAGCCCGCAGAAAA 134
Reverse CGTCCATGTTGGCTCTCAGT