Skip to main content

Table 1 List of primer sequences used in this study

From: Microglial depletion alters the brain neuroimmune response to acute binge ethanol withdrawal

18S F: 5'-GGTAACCCGTTGAACCCCAT
18S R: 5'-CAACGCAAGCTTATGACCCG
Iba1 F: 5'-GGATTTGCAGGGAGGAAAAG
Iba1 R: 5'-TGGGATCATCGAGGAATTG
CD68 F: 5'-TGTCTGATCTTGCTAGGACCG
CD68 R: 5'-GAGAGTAACGGCCTTTTTGTGA
TNFα F: 5'-GACCCTCACACTCAGATCATCTTCT
TNFα R: 5'-CCTCCACTTGGTGGTTTGCT
Ccl2 F: 5'-CCAGCCTACTCATTGGGAT
Ccl2 R: 5'-GGGCCTGCTGTTCACAGTT
IL-1ra F: 5'- CTGTTGGCTGGCCTAATCCC
IL-1ra R: 5'-GCTTTGAACAAGCACCTGCC
IL-4 F: 5'-TGGGTCTCAACCCCCAGCTAGT
IL-4 R: 5'-TGCATGGCGTCCCTTCTCCTGT
IL-10 F: 5'-GCTCTTACTGACTGGCATGAG
IL-10 R: 5'-CGCAGCTCTAGGAGCATGTG
Arg1 F: 5'-TTAGGCCAAGGTGCTTGCTGCC
Arg1 R: 5'-TACCATGGCCCTGAGGAGGTTC
CD11b F: 5'-GAGGCCCCCAGGACTTTAAC
CD11b R: 5'-CTTCTTGGTGAGCGGGTTCT
CX3CR1 F: 5'-TCTTCACGTTCGGTCTGGTG
CX3CR1 R: 5'- TGCACTGTCCGGTTGTTCAT
CSF1R F: 5'-GTCCACGGCTCATGCTGAT
CSF1R R: 5'-GTGAGTACAGGCTCCCAAGAG
CD86 F: 5'-ACGATGGACCCCAGATGCACCA
CD86 R: 5'-GCGTCTCCACGGAAACAGCA
CD206 F: 5'-TCAGCTATTGGACGCGAGGCA
CD206 R: 5'-TCCGGGTTGCAAGTTGCCGT
CD163 F: 5'-CTCTGAATGACCCCCGAGGA
CD163 R: 5'-CACGGCACTCTTGGTTTGTG
IL-1β F: 5'-CTGGTGTGTGACGTTCCCATTA
IL-1β R: 5'-CCGACAGCACGAGGCTTT
IL-6 F: 5'-GGCCTTCCCTACTTCACAAG
IL-6 R: 5'-ATTTCCACGATTTCCCAGAG
iNOS F: 5'-GCTATGGCCGCTTTGATGTG
iNOS R: 5'-TCGAACTCCAATCTCGGTGC
NOX2 F: 5'-GGGAACTGGGCTGTGAATGA
NOX2 R: 5'-CAGTGCTGACCCAAGGAGTT
TGFβ1 F: 5'-CTCCCGTGGCTTCTAGTGC
TGFβ1 R: 5'-GCCTTAGTTTGGACAGGATCTG
Ym1 F: 5'-ACCCCTGCCTGTGTACTCACCT
Ym1 R: 5'-CACTGAACGGGGCAGGTCCAAA
TLR2 F: 5'-GCAAACGCTGTTCTGCTCAG
TLR2 R: 5'-AGGCGTCTCCCTCTATTGTATT
TLR3 F: 5'-TTGTCTTCTGCACGAACCTG
TLR3 R: 5'-GGCAACGCAAGGATTTTATT
TLR4 F: 5'-GCCTTTCAGGGAATTAAGCTCC
TLR4 R: 5'-AGATCAACCGATGGACGTGTAA
TLR7 F: 5'-ATGTGGACACGGAAGAGACAA
TLR7 R: 5'-GGTAAGGGTAAGATTGGTGGTG
FasL F: 5'-TTGAAAAGCAAATAGCCAACCC
FasL R: 5'-CACTCCAGAGATCAGAGCGG
FasR F: 5'-GCACCCTGACCCAGAATACC
FasR R: 5'-GTTCCATGTTCACACGAGTC
NeuN F: 5'-AACTTATGGAGCGGTCGTGT
NeuN R: 5'-GGCCGATGGTGTGATGGTAA
MAP2 F: 5'-GAGGAAGCAGCAAGTGGTGA
MAP2 R: 5'-GGGAGGATGGAGGAAGGTCT
DCX F: 5'-GACACCATGTGCTTAGGGCT
DCX R: 5'-ATTTGGGCAGTTTTCCCCCT
GFAP F: 5'-TCCTGGAACAGCAAAACAAG
GFAP R: 5'-CAGCCTCAGGTTGGTTTCAT
S100β F: 5'-CTAGGCATTCCCGTGAGCTG
S100β R: 5'-ATGAGCAACCTCTTCGGGTG
MBP F: 5'-CCCTCACGTTATTGTGGCGA
MBP R: 5'-AGACCTTCCAAAGAGCCCCA
CNP F: 5'-GACATAGTACCCGCAAAGGC
CNP R: 5'-AAGAGCTTGGGCAGGAATGT
Pecam1 F: 5'-GCATCGGCAAAGTGGTCAAG
Pecam1 R: 5'-TTGCTGGGTCATTGGAGGTC
ICAM2 F: 5'-ACTGGCACAGAGGAGATTGTG
ICAM2 R: 5'-AGGCTCCAGCAAGCAAAAGA
CD200 F: 5'-CCGAGAAGCTGGTGTCTAGC
CD200 R: 5'-ACCACTTCCACTTGAGCTGT
CX3CL1 F: 5'- CAACTTCCGAGGCACAGGAT
CX3CL1 R: 5'- CCAAACGGTGGTGGAGATGT
c-Fos F: 5'-TGGCACTAGAGACGGACAGA
c-Fos R: 5'-TTTCAACGCCGACTACGAGG
EGR1 F: 5'-GCGATGGTGGAGACGAGTTA
EGR1 R: 5'-AGAGGTCGGAGGATTGGTCA
c-Jun F: 5'-TGGGCACATCACCACTACAC
c-Jun R: 5'-TGACACTGGGAAGCGTGTTC
Arc F: 5'-CCAAGCCCCAGCTCCAATTA
Arc R: 5'-CCTACACACCCTATGCCAGC
C3 F: 5'-CAGGACGTGAGAGTCGATGG
C3 R: 5'-CTCTGCCTATGCTGCCTTCA
C1qA F: 5'-GAAGGGCGTGAAAGGCAATC
C1qA R: 5'-CAAGCGTCATTGGGTTCTGC