Skip to main content

Table 1 Primers used in real-time qRT-PCR reactions

From: Isoliquiritigenin alleviates early brain injury after experimental intracerebral hemorrhage via suppressing ROS- and/or NF-κB-mediated NLRP3 inflammasome activation by promoting Nrf2 antioxidant pathway

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
NLRP3 CGGTGACCTTGTGTGTGCTT TCATGTCCTGAGCCATGGAAG
ASC GACAGTACCAGGCAGTTCGT AGTAGGGCTGTGTTTGCCTC
Caspase-1 GAACAAAGAAGGTGGCGCAT AGACGTGTACGAGTGGGTGT
IL-1beta CCTATGTCTTGCCCGTGGAG CACACACTAGCAGGTCGTCA
IL-18 ACCACTTTGGCAGACTTCACT ACACAGGCGGGTTTCTTTTG
Nqo1 GTTTGCCTGGCTTGCTTTCA ACAGCCGTGGCAGAACTATC
HO-1 GGTGATGGCCTCCTTGTACC GTGGGGCATAGACTGGGTTC
Actin TCAGCAAGCAGGAGTACGATG GTGTAAAACGCAGCTCAGTAACA