Skip to main content

Table 2 Primer sequences

From: Monocyte-derived tissue transglutaminase in multiple sclerosis patients: reflecting an anti-inflammatory status and function of the cells?

Gene Forward Reverse
TG2 5’AGAGGAGCGGCAGGAGTATG 3’ 5’AGGATCCCATCTTCAAACTGC 3’
GAPDH 5’TCAAGGGCATCCTGGGCTAC 3’ 5’CGTCAAAGGTGGAGGAGTGG 3’
POLR2F 5’GAACTCAAGGCCCGAAAG 3’ 5’TGATGATGAGCTCGTCCAC 3’
IL-1β 5’TACAGCTGGAGAGTGTAGATC 3’ 5’CAAATTCCAGCTTGTTATTG 3’
TNF-α 5’CCCAGGCAGTCAGATCATCTTC 3’ 5’CTCTCAGCTCCACGCCATTG 3’
IL-1ra 5’TCATCCGCTCAGACAGTGGC 3’ 5’AGCTTCCATCGCTGTGCAGA 3’
TGF-β1 5’CTTTCCTGCTTCTCATGGCC 3’ 5’CCGTGGAGCTGAAGCAATAG 3’
β1 integrin 5’TGTGGAGGAAATGGTGTTTGC 3’ 5’TCTGTCCGTTGCTGGCTTCA 3’
β3 integrin 5’CAATGCCACCTGCCTCAACA 3’ 5’GAGTCTTCATAGTACTGGAATC 3’
MMP-2 5’AAGGCCAAGTGGTCCGTGTG 3’ 5’GTGCAGCTGTTGTACTCCTTGC 3’
  1. TG2 Transglutaminase 2, GAPDH glyceraldehyde-3-phosphate-dehydrogenase, POLR2F polymerase (RNA) II polypeptide F, IL-1β interleukin-1β, TNF-α tumor necrosis factor-α, IL-1ra interleukin-1 receptor antagonist, TGF-β transforming growth factor-β1, MMP-2 matrix metalloproteinase s2