Skip to main content

Advertisement

Table 1 Primers used in real-time PCR analysis

From: Hypoxia mimetic activity of VCE-004.8, a cannabidiol quinone derivative: implications for multiple sclerosis therapy

Genes Forward (5′---3′) Reverse (5′---3′)
TNF-α CTACTCCCAGGTTCTCTTCAA GCAGAGAGGAGGTTGACTTTC
IL-6 GTATGAACAACGATGATGCACTTG ATGGTACTCCAGAAGACCAGAGGA3
CCL2 GGGCCTGCTGTTCACAGTT CCAGCCTACTCATTGGGAT
CCL4 AGAAACAGCAGGAAGTGGGA AACACCATGAAGCTCTGCGT
Arg-1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC
Mrc1 CATGAGGCTTCTCCTGCTTCTG TTGCCGTCTGAACTGAGATGG
IL-10 GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT
VEGF-A CGAAGTGGTGAAGTTCATGGATG TTCTGTATCAGTCTTTCCTGGTG
EPO CTCCGAACAATCACTGCT GGTCATCTGTCCCCTGTCCT
GAPDH TGGCAAAGTGGAGATTGTTGCC AAGATGGTGATGGGCTTCCCG
HPRT ATGGGAGGCCATCACATTGT ATGTAATCCAGCAGGTCAGCA