Skip to main content

Advertisement

Table 1 Real-time PCR primers (F, forward primer; R, reverse primer) and size of amplicon

From: Urate inhibits microglia activation to protect neurons in an LPS-induced model of Parkinson’s disease

Primer Forward (5′-3′) Reverse (5′-3′)
Mouse IL-1β CTgTgTCTTTCCCgTggACC CAgCTCATATgggTCCgACA
Mouse TNF-α CAGCCGATGGGTTGTACCTT TGTGGGTGAGGAGCACGTAGT
Mouse β-actin TgCTgTCCCTgTATgCCTCT TTgATgTCACgCACgATTTC
Rat IL-1β TCTGTGACTCGTGGGATGAT GGAGAATACCACTTGTTGGC
Rat TNF-α ACTCCCAGGTTCTCTTCAAG CAGAGAGGAGGCTGACTTTC
Rat GAPDH TGACATCAAGAAGGTGGTGAAGC GGAAGAATGGGAGTTGCTGTTG
  1. TNF-α, IL-1β, β-actin, and GAPDH genes were amplified using the forward and reverse primers listed in the above