Skip to main content

Table 1 Real-time PCR primers used in this study

From: TSG-6 attenuates inflammation-induced brain injury via modulation of microglial polarization in SAH rats through the SOCS3/STAT3 pathway

Primer name Primer sequence  
TSG-6 Forward CGTCTTGCAACCTACAAGCAGCTA
Reverse ACAGTTGGGCCCAGGTTTCA
CD86 Forward GATTGCAGGTCCCAGTTCACTTC
Reverse CCACTGTCCTGCTTGGACTCAC
CD68 Forward GGATTCAAACAGGACCGACAT
Reverse GGACACATTGTATTCCACTGCC
iNOS Forward TCCTCAGGCTTGGGTCTTGTTAG
Reverse TTCAGGTCACCTTGGTAGGATTTG
Arg-1 Forward GCTGTGGTAGCAGAGACCCAGA
Reverse CATCCACCCAAATGACGCATAG
CD163 Forward CTTTGGAATGGGCAAGAACAGAA
Reverse TGAGTGACAGCAGAGACGCTGA
CD206 Forward TGGAGTGGCAGGTGGTTTATG
Reverse GGTTCAGGAGTTGTTGTGGGC
IL-1β Forward AATGCCTCGTGCTGTCTGA
Reverse GGATTTTGTCGTTGCTTGTCTC
IL-6 Forward ATTGTATGAACAGCGATGATGCAC
Reverse CCAGGTAGAAACGGAACTCCAGA
TNF-α Forward TTCCAATGGGCTTTCGGAAC
Reverse AGACATCTTCAGCAGCCTTGTGAG
IL-4 Forward TGCACCGAGATGTTTGTACCAGA
Reverse TTGCGAAGCACCCTGGAAG
IL-10 Forward CAGACCCACATGCTCCGAGA
Reverse CAAGGCTTGGCAACCCAAGTA
TGF-β Forward CATTGCTGTCCCGTGCAGA
Reverse AGGTAACGCCAGGAATTGTTGCTA
β-actin Forward GGAGATTACTGCCCTGGCTCCTA
Reverse GACTCATCGTACTCCTGCTTGCTG