Skip to main content

Table 1 Sequences of primers used

From: Microglial NLRP3 inflammasome activation mediates IL-1β release and contributes to central sensitization in a recurrent nitroglycerin-induced migraine model

Gene Forward primer Reverse primer
NLRP3 CCATCAATGCTGCTTCGACA GAGCTCAGAACCAATGCGAG
IL-1β GTGAAATGCCACCTTTTGACAGTGA GAAGGTCCACGGGAAAGACAC
GAPDH AGACAGCCGCATCTTCTTGT TGATGGCAACAATGTCCACT