Skip to main content

Table 1 q-PCR primer sequences applied

From: TRPV1 mediates astrocyte activation and interleukin-1β release induced by hypoxic ischemia (HI)

Primer Forward primer 5′-3′ Reverse primer 5′-3
NLRP3 ACGAGTCCTGGTGACTTTGTAT TAGGTCCACACAGAAAGTTCTCTTA
Caspase1 ATGCCGTGGAGAGAAACAAGG CCCCTGACAGGATGTCTCCA
ASC ACGAGTCCTGGTGACTTTGTAT TAGGTCCACACAGAAAGTTCTCTTA
IL-1β TAAAGACCTCTATGCCAACACAGT CTGACTTGGCAGAGGACAAAG
IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTACTTC
TNF CCAACAAGGAGGAGAAGTTCC CTCTGCTTGGTGGTTTGCTAC
IL-10 TACTGCTAACCGACTCCTTAATGC AGAAATCGATGACAGCGCCTC
β-actin CACGATGGAGGGGCCGGACTCATC TAAAGACCTCTATGCCAACACAGT