Skip to main content

Advertisement

Table 1 List of primers used in RT-qPCR

From: BET protein inhibition regulates cytokine production and promotes neuroprotection after spinal cord injury

Gene F′ R′
ARG1 GTGAAGAACCCACGGTCTGT CCAGAGATGCTTCCAACTGC
IL-1b CTTCAAATCTCACAGCAGCACATC CCACGGGAAAGACACAGGTAG
IL-4 CATGGGAAAACTCCATGCTT TGGACTCATTCATGGTGCAG
IL-6 AACCACGGCCTTCCCTACTTCA TCATTTCCACGATTTCCCAGAG
IL-10 GCTCCTAGAGCTGCGGACT TCATTTCCGATAAGGCTTGG
IL-13 TCCAATTGCAATGCCATCTA TGGGCTACTTCGATTTTGGT
CD206 ATTGTGGAGCAGATGGAAGG ATTTGCATTGCCCAGTAAGG
CCL2 ATGGGTACCGTCACAACCTC CCTGCTGCTGGTGATTCTCTT
CCL5 TGCCCACGTCAAGGAGTATTTCTA TGGCGGTTCCTTCGAGTGACAA
CD68 CCAATTCAGGGTGGAAGAAA ATGGGTACCGTCACAACCTC
CX3CR1 CTTTGGGGGCATATTCTTCA ACGCCCAGACTAATGGTGAC
GAPDH TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCG
GFAP GGAGAGGGACAACTTTGCAC CAGCCTCAGGTTGGTTTCAT
INOS AATCTTGGAGCGAGTTGTGG CAGGAAGTAGGTGAGGGCTTG
TNFa AGGCACTCCCCCAAAAGATG TCACCCCGAAGTTCAGTAGAC