Skip to main content

Advertisement

Table 1 Primer sequences for qRT-PCR

From: Lipopolysaccharide induces neuroinflammation in microglia by activating the MTOR pathway and downregulating Vps34 to inhibit autophagosome formation

GeneForward primerReverse primer
Tnf-α5′ AGACCCTCACACTCAGATCATCTTC 3′5′ TTGCTACGACGTGGGCTACA 3′
Il-65′ TAGTCCTTCCTACCCCAATTTCC 3′5′ TTGGTCCTTAGCCACTCCTTC 3′
Inos5′ GGCAAACCCAAGGTCTACGTT 3′5′ GAGCACGCTGAGTACCTCATTG 3′
Gapdh5′ GGCAAATTCAACGGCACA 3′5′ GAGCACGCTGAGTACCTCATTG 3′