Skip to main content

Table 1 List of primer sequences used in qPCR analysis

From: Palmitoylethanolamide counteracts substance P-induced mast cell activation in vitro by stimulating diacylglycerol lipase activity

GeneForward sequences (5'->3')Reverse sequences (5'->3')
Cnr1CTGAGGGTTCCCTCCCGGCATGCTGGGACCAACGGGGAGT
Cnr2GCAACTTCGTCATCTTCCAGCACAGACATAGGTATCG
Trpv1CATCTTCACTACCAGGAGTGGATAGTTAGAACAGAGC
PparaCCTCAGGATACCACTATGTGTTCACAGGTAAGGATT
Gpr55TCTTCTGGTCAATCACTTAATGCTCAGTAGAATGTG
NapepldCGCCAAGCCATCAGTATCCATCCTTCTCCATTATCAGCCATC
DaglaATGATGGTGCCTGAGAGCAGTGGGAAGGAGGGTGAG
DaglbAAGGTATCCAATGTGACAGGCAGCGATGACAATCCAACT
FaahACTGCGTGACCTCCTATCCACAGTCAGATTCCGATGG
NaaaCACTTTTGTTGGCTATGTAGTCTCGTTCATCACCAGAA
MglGTCCTTGCTGCCAAACTGTCCGACTTGTTCCGAGAC
β-actinCCAGGCATTGCTGACAGGTGGAAGGTGGACAGTGAGG
HPRTTTGACACTGGTAAAACAATGCGCCTGTATCCAACACTTCG