Skip to main content

Advertisement

Table 1 Primer sequences used for real-time polymerase chain reaction analysis

From: Pellino1 regulates neuropathic pain as well as microglial activation through the regulation of MAPK/NF-κB signaling in the spinal cord

Gene nameForward primer sequence (5'-3')Reverse primer sequence (5'-3')
Peli1CCTTGTCCATGTAAGTTTCTCCAGAGTTCAGAAGTCTGGAAC
Iba1GGATTTGCAGGGAGGAAAAGTGGGATCATCGAGGAATTG
CD11bTCCGGTAGCATCAACAACATGGTGAAGTGAATCCGGAACT
GFAPGCACTCAATACGAGGCAGTGGGCGATAGTCGTTAGCTTCG
iNOSGGCAGCCTGTGAGACCTTTGCATTGGAAGTGAAGCGTTTCG
TNF-αCATCTTCTCAAAATTCGAGTGACAACCAGCTGCTCCTCCACTTG
IL-6CACAGAGGATACCACTCCCAACATCCACGATTTCCCAGAGAACA
IL-1βTGAGGCCCAAGGCCACAGGTCATCTTCTCAAAATTCGAGTGACAA
CD86ACGATGGACCCCAGATGCACCAGCGTCTCCACGGAAACAGCA
Arg1TTAGGCCAAGGTGCTTGCTGCCTACCATGGCCCTGAGGAGGTTC
CD206TCAGCTATTGGACGCGAGGCATCCGGGTTGCAAGTTGCCGT
Ym1CACTGAACGGGGCAGGTCCAAAACCCCTGCCTGTGTACTCACCT
IL-10GGCAGAGAACCATGGCCCAGAAAATCGATGACAGCGCCTCAGCC
GAPDHUUCUCCGAACGUGUCACGUTTUUCUCCGAACGUGUCACGUTT
  1. Peli1 Pellino1, Iba1 ionized calcium binding adapator molecule 1, CD11b cluster of differentiation 11b, GFAP glial fibrillary acidic protein, iNOS inducible nitric oxide synthase, TNF-α tumor necrosis factor α, IL-6 interleukin 6, IL-1β interleukin 1β, CD86 cluster of differentiation 68, Arg1 arginase 1, CD206 cluster of differentiation 206, Ym1 chitinase-like protein 3, IL-10 interleukin 10, GAPDH glyceradehyde-3 phosphate dehydrogenase