Skip to main content

Table 1 Primer sequences

From: The CD200/CD200R signaling pathway contributes to spontaneous functional recovery by enhancing synaptic plasticity after stroke

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
Il-1β TCCAGGATGAGGACCCAAGC TCGTCATCATCCCACGAGTCA
Il-6 CAGGAACGAAAGTCAACTCCA ATCAGTCCCAAGAAGGCAACT
Tnf-α TTCCCAAATGGGCTCCCTCT GTGGGCTACGGGCTTGTCAC
Il-4 CAGGGTGCTTCGCAAATTTTAC ACCGAGAACCCCAGACTTGTT
Cd206 GGTTCCGGTTTGTGGAGCAG TCCGTTTGCATTGCCCAGTA
Gapdh CAGCCTCGTCTCATAGACAAGATG AAGGCAGCCCTGGTAACCA