Skip to main content

Table 1 PPrimers sequences for qRT-PCR

From: FGF21 alleviates neuroinflammation following ischemic stroke by modulating the temporal and spatial dynamics of microglia/macrophages

Gene Primer sequences (5′ to 3′)
β-Actin Forward CACTGCAAACGGGGAAATGG
Reverse TGAGATGGACTGTCGGATGG
IL-1β Forward GCG CTG CTC AAC TTC ATC TTG
Reverse GTG ACA CAT TAA GCG GCT TCA C
IL-6 Forward CTC CCA ACA GAC CTG TCT ATA C
Reverse CCA TTG CAC AAC TCT TTT CTC A
TNF-α Forward GTG ACA AGC CTG TAG CCC A
Reverse ACT CGG CAA AGT CGA GAT AG
Cox-2 Forward CCCTTGGGTGTCAAAGGTAA
Reverse GCCCTCGCTTATGATCTGTC
MCP-1 Forward ATAGCAGCCACCTTCATTCC
Reverse TTCCCCAAGTCTCTGTATCT
CXCL1 Forward ACC GAA GTC ATA GCC ACA CCTC AAG
Reverse TTG TCA GAA GCC AGC GTT CAC C
IL-10 Forward TTC TTT CAA ACA AAG GAC CAG C
Reverse GCA ACC CAA GTA ACC CTT AAA G
TGF-β Forward TTGCTTGAGCTCCACAGAGA
Reverse TGGTTGTAGAGGGCAAGGAC