Skip to main content

Table 2 List of TaqMan microRNA assays used for custom RT pool and qPCR on miRNAs

From: Decreased expression of miR-29 family associated with autoimmune myasthenia gravis

Assay ID miRNA name miRBase ID Sequence
002112 hsa-miR-29a-3p MIMAT0000086 UAGCACCAUCUGAAAUCGGUUA
002447 hsa-miR-29a-5p MIMAT0004503 ACUGAUUUCUUUUGGUGUUCAG
000413 hsa-miR-29b-3p MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU
002165 hsa-miR-29b-1-5p MIMAT0004514 GCUGGUUUCAUAUGGUGGUUUAGA
002166 hsa-miR-29b-2-5p MIMAT0004515 CUGGUUUCACAUGGUGGCUUAG
000587 hsa-miR-29c-3p MIMAT0000681 UAGCACCAUUUGAAAUCGGUUA
001818 hsa-miR-29c-5p MIMAT0004673 UGACCGAUUUCUCCUGGUGUUC