Skip to main content

Table 1 Real-time PCR primers used in this study

From: Low-density lipoprotein receptor (LDLR) regulates NLRP3-mediated neuronal pyroptosis following cerebral ischemia/reperfusion injury

Primer name Primer sequence
NLRP3 Forward ATGCTGCTTCGACATCTCCT
Reverse AACCAATGCGAGATCCTGAC
Pro-IL-1β Forward CAGGCAGGCAGTATCACTCA
Reverse AGGCCACAGGTATTTTGTCG
Pro-IL-18 Forward GACTCTTGCGTCAACTTCAAGG
Reverse CAGGCTGTCTTTTGTCAACGA
GAPDH Forward AAGAAGGTGGTGAAGCAGGC
Reverse TCCACCACCCAGTTGCTGTA